Padrão de Virulência da Escherichia coli enteroagregativa e
Propaganda
CENTRO UNIVERSITÁRIO DO MARANHÃO PRÓ-REITORIA DE PÓS-GRADUAÇÃO, PESQUISA E EXTENSÃO PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA PARASITÁRIA Padrão de Virulência da Escherichia coli enteroagregativa e enteropatogênica atípica SÃO LUÍS 2010 THIAGO AZEVEDO FEITOSA FERRO PADRÃO DE VIRULÊNCIA DA ESCHERICHIA COLI ENTEROAGREGATIVA E ENTEROPATOGÊNICA Dissertação apresentada ao Programa de PósGraduação em Biologia Parasitária como parte dos requisitos para a obtenção do título de Mestre em Biologia Parasitária. Orientador: Profa. Dra. – Patrícia Figueiredo Co-orientador: Prof. Dr – Valério Monteiro Neto SÃO LUÍS 2010 Ficha Catalográfica Ferro, Thiago Azevedo Feitosa Padrão de Virulência da Escherichia coli enteroagregativa e enteropatogênica atípica: / Thiago Azevedo Feitosa Ferro. São Luís: UNICEUMA, 2010. 94p.:il. Dissertação (Mestrado) - Mestrado em Biologia Parasitária. Centro Universitário do Maranhão, 2010. 1. Escherichia coli. 2. Biologia Parasitária I. Figueredo, Patrícia Maria S. (Orientador) II. Título. CDU:573:576.8 AGRADECIMENTOS À Deus, que me protegeu durante a realização deste trabalho. À minha esposa Carla Danielle e ao meu filho Iago, pelo carinho, compreensão e constante incentivo. À Profa. Dra Patrícia Figueredo, que conduziu esse projeto com muito interesse e competência. Aos Profs Dr Valério Monteiro e Dra Cristina Monteiro, pelo auxílio e prontidão. Aos colegas de laboratório pela colaboração direta ou indireta para com este trabalho. Ao meu pai Aderson e minha mãe Solange, pelo sempre e incondicional carinho e estímulo. Ao Centro Universitário do Maranhão, em especial ao departamento de Pesquisa de Biologia Parasitária, e ao Fundo de Apoio a Pesquisa do Estado do Maranhão. SUMÁRIO LISTA DE FIGURAS ................................................................................................... i LISTA DE TABELAS .................................................................................................. ii LISTA DE ABREVIATURAS ..................................................................................... iii RESUMO ................................................................................................................... v ABSTRACT ............................................................................................................... vi 1. INTRODUÇÃO .................................................................................................. 14 2. REVISÃO BIBLIOGRÁFICA ................................................................................. 16 2.1.Hemolisinas ................................................................................................. 18 2.2.Adesão ........................................................................................................ 19 2.3 Resistência à antibióticos ............................................................................ 20 3. OBJETIVOS ......................................................................................................... 22 3.1. Objetivo Geral ............................................................................................. 22 3.2. Objetivos Específicos ................................................................................. 22 4. METODOLOGIA .................................................................................................. 23 4.1. Identificação do patógeno ........................................................................... 23 4.2. Identificação molecular das categorias patogênicas de Escherichia coli e seus marcadores de virulência ................................................................................. 23 4.2.1. Eletroforese de DNA em gel de agarose .................................................. 24 4.3. Detecção da atividade hemolítica .............................................................. 28 4.3.1. Pesquisa da atividade hemolítica em meio sólido .................................... 28 4.3.2 Pesquisa da atividade hemolítica no sobrenadante da cultura .................. 28 4.3.3. Pesquisa de hemólise de contato ............................................................ 29 4.4. Infulência da presença de íons, quelantes, protetores osmóticos e soro na atividade da hemolisina ........................................................................................... 29 4.4.1 Cultivo na presença de agentes quelantes e íons ..................................... 29 4.4.2. Teste de hemólise com protetores osmóticos .......................................... 30 4.4.2. Inibição da atividade hemolítica por soro ................................................. 30 4.5.Produção de biofilme ................................................................................... 30 4.5.1. Produção de biofilme em Ágar Vermelho Congo ..................................... 30 4.5.2. Produção de biofilme em microplaca ....................................................... 31 4.6. Identificação de fímbrias ............................................................................. 32 4.6.1. Identificação de fímbria curli .................................................................... 32 4.6.2. Identificação de fímbria tipo I ................................................................... 32 4.7. Resistência ao soro .................................................................................... 32 4.8. Teste de resistência aos antimicrobianos ................................................... 34 4.9. Análise estatística ....................................................................................... 34 5. RESULTADOS ..................................................................................................... 36 5.1.1.Pesquisa de hemolisina ............................................................................ 36 5.1.2.Influência de diferentes condições de cultivo na atividade hemolítica ....... 37 5.2.Produção de biofilme ................................................................................... 40 5.3. Identificação de isolados produtores de fímbrias: curli e fímbria tipo I ........ 41 5.4. Categorizçaão dos marcadores de virulência entre os isolados .................. 42 5.5. Resistência aos antimicrobianos................................................................. 44 5.6. Resistência aos ao soro ............................................................................. 47 5.7. Prevalência entre marcadores e fatores de virulência dos isolados de EAEC e EPEC .................................................................................................................... 48 6. DISCUSSÃO ........................................................................................................ 51 7.CONCLUSÃO ....................................................................................................... 57 8.REFERÊNCIAS BIBLIOGRÁFICAS ...................................................................... 58 APÊNDICE A – American Journal of Tropical Medicine and Hygiene Instructions for Authors .................................................................................................................... 64 8.APÊNDICE B - SUBMISSÃO ................................................................................ 75 8.APÊNDICE C - ARTIGO ....................................................................................... 76 i LISTA DE FIGURAS Fig 1. Hemólise de eritrócito de carneiro, dos quatro isolados com atividade hemolítica, na presença de íons de cálcio, férrico, níquel e magnésio; dos quelantes EDDA e EDTA; meio puro; e Soro normal humano. Está descrito a média, as suiças representamo desvio padrão. ● representa o valor máximo ou mínimo da atividade hemolítica ................................................................................................................ 40 Fig 2. Categorização da produção de biofilme entre isolados de EAEC e EPEC atípica por análise realizado por espectrofotometria. D.O.i/D.O.c - razão entre a absorbância do isolado e do controle negativo. X - valor da razão da absorbância igual a 2. .................................................................................................................. 41 Fig. 3. Sobrevivência de isolados de EAEC e EPEC atípica, por tempo de incubação, em soro humano normal (A), soro tratado com EDTA (B) e soro inativado por aquecimento a 56ºC por 30 minutos. Os resultados estão representados como a média dos isolados distribuídos nas três categorias (sensível, resistência intermediária e resistente) realizados em experimentos individuais. A sobrevivência relativa, no tempo inicial foi considerada como 100%. * - apenas um isolado foi categorizado para cada uma das linhas assinaladas ............................................... 48 ii LISTA DE TABELAS Tabela 1. Linhagens bacterianas estudadas neste trabalho ..................................... 24 Tabela 2. Relação de marcadores de virulência utilizados neste estudo .................. 26 Tabela 3 . Expressão de hemolisina de Escherichia coli em placas de Muller-Hintonsangue, com diferentes hemácias, observada em diferentes tempos (horas) de cultivo....................................................................................................................... 37 Tabela 4. Atividade hemolítica de isolados de EAEC e EPEC atípica em sangue de carneiro com diferentes constituintes de cultivo EAEC e EPEC atípica em sangue de carneiro com diferentes constituintes de cultivo. ...................................................... 39 Tabela 5. Presença de curli, Fímbria tipo I e Produção de Biofilme entre os isolados de EAEC e EPEC atípica. ........................................................................................ 42 Tabela 6.Distribuição de beta-lactamases de espectro estendido (ESBL) entre os isolados de EAEC e EPEC atípica. .......................................................................... 43 Tabela 7. Distribuição de marcadores de virulência entre Escherichia coli enteroagregativa e enteropatogênica atípica............................................................ 44 Tabela 8. Perfil de sensibilidade a antimicrobianos dos isolados de EAEC e EPEC atípica.,. ................................................................................................................... 46 Tabela 9. Frequência relativa e absoluta dos fatores de virulência, marcadores e genes responsáveis pela produção de beta-lactamases de espectro estendido (ESBL).,. .................................................................................................................. 50 iii LISTA DE ABREIATURAS AVC – Ágar Vermelho Congo bfp – pilus em forma de cacho BHI – Infusão de cérebro e coração cdt – Toxina citoletal distensora DAEC – Escherichia coli difusamente aderente D.O.c. – Densidade óptica do controle D.O.i. – Densidade óptica do isolado EAF – plasmídio de fator de aderência da Escherichia coli enteropatogênica EAEC – Escherichia coli enteroagregativa EAST - Enterotoxina termoestável de E. coli enteroagregativa EDDA - Etileno-di (o-hidroxifenol) ácido acético EDTA - Etilenodiamina-tetra ácido acético efa1 – EHEC fator de aderência EHEC – Escherichia coli enterohemorrágica ehx - enterohemolisina EIEC – Escherichia coli enteroinvasora EPEC – Escherichia coli enteropatogênica ESP – Espectofotometria iv ESBL – beta-lactamase de espectro estendido ETEC - Escherichia coli enterotoxigênica HEp-2 - Células de carcinoma de laringe humana HMR – Hemaglutinação Manose Resistente HMS – Hemglutinação Manose Sensível iha – adesina homóloga a irgA irp – Sideróforo yersiniabactina LEE – locus de apagamento do enterócito LB – meio Luria Bertani LT – toxina termolábil pAA – plasmídio de aderência agregativa PBS - Tampão fosfato salina PCR – Reação em cadeia da Polimerase RTX – Toxina de estrutura repetida ST – toxina termoestável TBE – Tris borato Etilenodiamina-tetra ácido acético UNICEUMA – Centro Universitário do Maranhão v RESUMO Escherichia coli é um microorganismo Gram-negativo pertencente ao grupo dos coliformes, e um importante agente de diarreia infantil. Ela pode possuir diferentes fatores de virulência e esses são definidos como estruturas, produtos ou estratégias que contribuem para o microorganismo aumentar sua capacidade em causar a infecção. O presente estudo tem como objetivo investigar presença destes fatores em isolados obtidos de casos clínicos de diarreia infantil e interrelacioná-los. Dezenove isolados de Escherichia coli, entre linhagens de enteropatogênico e enteroagregativo, foram caracterizados quanto aos diferentes fatores de virulência por análises fenotípicas e genotípicas. Cerca de 94% dos isolados apresentaram resistência ao soro, 78% fímbria curli, 73% produção de biofilme em diferentes níveis, 68% algum gene para produção de beta-lactamases, 21% produção de hemolisina, 15% fímbria tipo I e 10% o sideróforo yersiniabactina. Os isolados com atividade hemolítica apresentaram maior número de fatores de virulência. Em relação hemólise, foi visto que e que esta atividade foi mais forte nos meio que continham EDDA; diminuída nos que continham ferro e EDTA; e similares nos que continham cálcio e soro humano. Esses resultados sugerem que os isolados de Escherichia coli enteropatogênico atípico e enteroagregativo, caracterizados neste estudo, são heterogêneos quanto à presença dos fatores de virulência,não sendo possível associar quaisquer destas propriedades ou combinação. vi ABSTRACT Escherichia coli is a Gram-negative microorganism belong to the coliforms group, and a important diarrheal childhood agent. Its can presents different virulence factors and theses is defined like structures, products or strategies which to contribute the microorganism increase your capacity in cause infection. The present study aims at investigating the presence theses factors in isolates of Escherichia coli from clinical diarrheal cases and interrelating them. Twenty nine isolates of Escherichia coli, between enteropathogenic and enteroaggregative strains, were characterized due to the different virulence factors for phenotypic and genotypic analysis. About 94% the isolates presented resistance to the serum, 78% curli fimbriae, 73% biofilms production in different levels, 68% some gene to the beta-lactamases production, 21% hemolysin production, 15% fimbriae type I and 10% yersiniabactin siderophore. The isolates with hemolytic activities presented more virulence factors. About hemolysis; this activity was stronger at medium with EDDA; decreased at medium with iron and EDTA; and similar in medium with calcium and human serum. Theses results suggest that the isolates of atypical enteropathogenic and anteroaggregative Escherichia coli, characterized in this study, are heterogeneous as to the presence his virulence factors, without correlation among these proprieties or combination them. 14 1. INTRODUÇÃO Um levantamento realizado pela Organização Mundial de Saúde, de 2000 a 2003, constatou que 73% dos 10,6 milhões de mortes anuais de crianças menores de cinco anos estavam relacionados a cinco causas, sendo a doença diarréica a segunda mais comum com 18%, depois da pneumonia com 19%, o que demonstra a importância da enfermidade para a saúde pública, uma vez que causa profundos impactos sobre as taxas de morbidade e mortalidade infantil, principalmente nas regiões menos desenvolvidas do mundo (BRYCE et al., 2005). Apesar dos estudos mais recentes demonstrarem que houve uma redução significativa nos índices de mortalidade infantil por diarréia de 4,6 milhões por ano para aproximadamente 2,5 milhões por ano em todo o mundo, tais valores ainda são considerados altos e os índices de morbidade permanecem tão elevados quanto os observados há 30 anos (KOSEK, BERN, GUERRANT, 2003). Altas taxas de morbidade por doença diarréica são preocupantes porque a diarréia infantil pode deixar seqüelas que se manifestarão em longo prazo sobre o desenvolvimento físico e cognitivo da criança (BLACK, BROWN, BECKER, 1984). Vários patógenos estão relacionados com a diarreia no ser humano. Entre os agentes que são classicamente reconhecidos, destacam-se alguns vírus (Adenovírus, Astrovírus, Rotavírus), parasitos intestinais (Entamoeba hystolitica, Giardia lamblia, Strongyloides stercoralis) e bactérias (Aeromonas, Campylobacter, Clostridium dificille, Plesiomonas shigelloides, Salmonella enterica, Shigella, Vibrio Escherichia coli enteropatogênica, E. coli enterotoxigênica, E. coli enteroinvasora, E. coli enterohemorrágica, E. coli enteroagregativa). Apesar dessa ampla variedade de agentes etiológicos, linhagens de Escherichia coli são os mais prevalentes na 15 infância e representam o maior problema de saúde pública em países em desenvolvimento (DENNEHY, 2005; MOYO et al., 2007). Deste modo, as cepas diarreiogênicas da E. coli são categorizadas segundo suas propriedades de virulência. Estas características são definidas como estruturas, produtos ou estratégias que contribuem para a bactéria aumentar sua capacidade em causar infecção (BUERIS et al., 2007). Entre estas propriedades, destacam-se aquelas que permitam à bactéria reconhecer e colonizar a superfície das células do hospedeiro (adesinas fimbriais e não-fimbriais); a produção de toxinas e hemolisinas; expressão de sistemas de captação de ferro (sideróforos); e resistência a antibióticos e ao sistema imunológico. Contudo, apesar da sua elevada prevalência, a enteropatogenicidade de algumas dessas linhagens ainda não está completamente estabelecida, principalmente para E. coli enteropatogênica (EPEC) e E. coli enteroagregativa (EAEC) (NATARO, KAPER, 1998; TRABULSI, KELLER, TARDELLI GOMES, 2002; BOISEN et al., 2008). Isto se deve há poucos estudos sistemáticos sobre suas propriedades de virulência e a heterogeneidade destas características (MULLER et al., 2006; FLORES, OKHUYSEN, 2009; REGUA-MANGIA et al., 2009; TENNANT et al., 2009). Desta forma, a presente proposta visa abordar algumas das lacunas de conhecimentos existentes com relação aos aspectos de virulência da EAEC e EPEC em casos de diarreia infantil presentes na cidade de São Luís e em áreas de “ressaca”, na cidade de Macapá. Isto se torna relevante devido à falta de estudos que abordem esta temática nas regiões mencionadas. 16 2. REVISÃO BIBLIOGRÁFICA E. coli apresenta-se como um bacilo Gram-negativo, não esporulado, usualmente móvel, devido a presença de flagelos peritríquios, que frequentemente apresenta fímbrias e cápsula. É um anaeróbio facultativo, capaz de se desenvolver por metabolismo fermentativo (KAPER, NATARO, MOBELY, 2004). Algumas linhagens podem proporcionar benefícios ao organismo hospedeiro. Estas linhagens fazem parte da microbiota normal do trato intestinal e ajudam a prevenir possíveis infecções por bactérias patogênicas, além de sintetizarem vitaminas úteis ao bom funcionamento do organismo. Entretanto algumas cepas patogênicas podem provocar diversos cenários clínicos, como: meningites, infecção do trato urinário, diarreia e sepse (FERRIERES, HANCOCK, KLEMM, 2007b; SHARMA, YADAV, CHAUDHARY, 2009). Escherichia coli patogênica é agrupada em categorias baseadas pela produção de fatores de virulência. Virulência é definido como a habilidade de um organismo provocar doença em um hospedeiro particular, devido ao impacto cumulativo de um ou vários fatores de virulência (NAVEEN, MATHAI, 2005). Dentre as E. coli diarreiogênicas duas linhagens se destacam na prevalência da diarreia infantil, a enteropatogênica (EPEC) e a enteroagregativa (EAEC). A EPEC é o principal agente em crianças menores de seis meses de idade. Este patógeno causa lesão histopatológica conhecida como “adesão e apagamento” (attaching and effacement). Todas as linhagens apresentam uma ilha de patogenicidade cromossomial denominada locus de apagamento do enterócito (LEE) (BUERIS et al., 2007) Contudo, devido ao seu perfil genético, esta linhagem pode ser subdividida em típica e atípica. A ausência do plasmídio denominado fator de aderência da 17 EPEC (EAF), responsável pela produção do pilus em forma de cachos (bfp), é o que caracteriza a linhagem de EPEC atípica. De forma geral, EPEC atípica é mais heterogênea nas suas características de virulência do que a EPEC típica, pois apresenta outros marcadores de virulência dispersos em ilhas de patogenicidade além das regiões LEE e EAF. Por outro lado, atualmente, apresenta uma maior prevalência quando comparado com a EPEC típica (TRABULSI et al., 2002; BUERIS et al., 2007). Já a EAEC tem emergido como um importante patógeno em vários cenários clínicos, incluindo diarreia do viajante e diarreia persistente entre pacientes pediátricos e HIV positivos. É definido como a linhagem que não secreta as toxinas termoestável (ST) e termolábel (LT) da E. coli enterotoxigênica (ETEC) e caracterizada pelo padrão de aderência agregativa a culturas de células HEp-2. Os genes específicos da EAEC são controlados pelo regulador global denominado AggR. Este é codificado pelo plasmídio de aderência agregativa (pAA) (BOISEN et al., 2008). Devido ao seu padrão de virulência heterogêneo, a EAEC pode causar uma ampla variedade de danos ao hospedeiro: encurtamento das vilosidades; necrose hemorrágica das pontas das vilosidades; resposta inflamatória média com edema e infiltração mononuclear da submucosa (NATARO, STEINER, GUERRANT, 1998). Estas características de patogenicidade habilitam as amostras portadoras a realizarem uma gama variada de funções, como: processos de adesão; invasão e/ou destruição de tecidos; produção de toxinas; ou captação de produtos essenciais ao hospedeiro. A combinação destes fatores é determinante para a instalação da doença e sua severidade. 18 2.1 Adesão O primeiro estágio para que as linhagens de E. coli iniciem um processo infeccioso é a adesão. Isto invoca uma estratégia das bactérias fixarem nas células do hospedeiro e expressarem outras propriedades da sua patogenicidade. A capacidade de aderir de maneira firme é mediada por organelas de superfície bacteriana denominada adesinas ou fatores de colonização, que podem ser classificadas, de maneira geral, em estruturas protéicas ou exopolissacarídeos, nas quais permitem a liberação de toxinas para o interior da célula do hospedeiro e/ou a invasão desta, sendo o passo inicial na patogenicidade de E. coli diarreiogênica (SHERLOCK et al., 2004; SHERLOCK, VEJBORG, KLEMM, 2005). As adesinas de natureza polissacarídica compreendem cápsulas bacterianas, capazes de promover adesão inespecífica as células e outras superfícies. Há também estruturas fimbriais, que são estruturas protéicas filamentosas que podem apresentar ligação específica e inespecífica. Deste modo a E. coli diarreiogênica pode apresentar dois tipos principais de fímbrias: fímbria tipo 1 e a curli. A fímbria tipo 1 tem a capacidade de aglutinar eritrócitos e aderir a uma grande variedade de células (OTTO et al., 2001). Curli é uma adesina produzida por algumas linhagens do gênero da Escherichia e Salmonella, que se liga a proteínas do hospedeiro e ativa mediadores inflamatórios. Ela tem o papel na autoagregação bacteriana e na formação de biofilme. Estudos argumentam que as linhagens portadoras desta estrutura são, geralmente, mais invasoras, o que contribuiria para sepse bacteriana (UHLICH, KEEN, ELDER, 2002; UHLICH, COOKE, SOLOMON, 2006; DYER et al., 2007) 19 2.2 Hemolisinas Após a colonização dos tecidos do hospedeiro a E. coli pode apresentar a capacidade de expressar toxinas com distintas finalidades. Dentre estas a hemolisina demonstra um importante papel na virulência pois promove atividade citolítica, preferencialmente, de eritrócitos. Esta proteína é importante para obtenção de ferro e assim favorecer o crescimento bacteriano. Alguns isolados de E. coli são capazes de produzir simultaneamente vários tipos de hemolisinas (FIGUEIREDO, CATANI, YANO, 2003; HUNT et al., 2008). O isolamento de cepas hemolíticas de E. coli estimulou o interesse na importância da hemolisina na doença diarréica. Há três tipos principais desta proteína: α-hemolisina, β-hemolisina e enterohemolisina (WYBORN et al., 2004; HUNT et al., 2008; ALDICK et al., 2009). Dentre estas toxinas mencionadas anteriormente, a α-hemolisina é a mais prevalentes nas cepas diarreiogências e pertence a um grupo de toxinas formadoras de poros, liberada no meio extracelular, agrupada na família das toxinas de estrutura repetida (RTX). RTX são toxinas que foram primeiramente caracterizadas como hemolisinas e leucotoxinas, mas também afetam células endoteliais e renais Esta hemolisina pode ser sintetizada, também, por Proteus e Morganella spp., Pasteurella hemolytica, e Actinobacillus spp. (VALEVA et al., 2005; SKALS et al., 2009). Como a α-hemolisina, a enterohemolisina é uma RTX, contudo ela não é liberado no meio extracelular. Os primeiros relatos de linhagens de E. coli produtoras de enterohemolisina se deu em casos de epidemia de diarreia infantil na Alemanha e Estados Unidos (ALDICK et al., 2009; SASAKI et al., 2009) Ainda não se sabe ao certo o papel destas toxinas no processo diarréico, mas se tem estabelecido que alguns isolados produtores de hemolisinas tendem a 20 aumentar os níveis de citocinas proinflamatórias, e que isto contribui para o quadro clínico do hospedeiro (COOKSON et al., 2007). . 2.3 Resistência à antibióticos Além dos fatores supracitados, outra importante estratégia para a sobrevivência encontrada entre Enterobacteriaceae e que vem aumentando no mundo, é denominada fator de resistência à antimicrobianos (fator R). O principal mecanismo de resistência é a produção de β-lactamases de espectro estendido (ESBL). O tratamento de infecções causadas por cepas produtoras de ESBL oferece um substancial desafio à terapia antimicrobiana, pois as ESBLs são capazes de hidrolisar monobactâmicos, penicilinas, minimizando cefalosporinas as opções de todas as terapêuticas gerações e (CHAUDHARY, AGGARWAL, 2004). As ESBLs são um grupo heterogêneo de enzimas que são codificadas por genes plasmidiais. Estas enzimas atualmente são compostas por cerca de 890 enzimas distintas, cujo o grau de resistência varia para cefalosporinas, penicilinas e inibidores de β-lactâmicos (SLAMA, 2008; HAWSER et al., 2009; BUSH, JACOBY, 2010). A primeira enzima bacteriana responsável pela destruição da penicilina foi a β-lactamase Amp-C produzida pela E.coli em 1940 (JACOBY, 2009). Pacientes com infecções devido a enterobactérias produtoras de β-lactamases de espectro estendido (ESBL) apresentam um resultado menos satisfatório, pois está associado com alta taxa de falha no tratamento (>80%) e mortalidade (>35%) (PEREZ et al., 2008). 21 Uma recente mudança da distribuição de ESBLs têm ocorrido em várias partes do mundo, com aumento das enzimas CTX-M em relação as variantes TEM e SHV. Embora ESBLs continuam sendo a primeira causa constitutiva de betalactâmicos entre Enterobacteriacea, outros tipos recentes destas enzimas estão conferindo resistência a carbapenens, como as metalo-beta-lactamases ou cefamicinas, como a enzima CMY (COQUE, BAQUERO, CANTON, 2008) 22 3 OBJETIVOS 3.1 OBJETIVO GERAL Detectar a presença de fatores de virulência em amostras de Escherichia coli enteropatogênica atípica e Escherichia coli enteroagregativa isoladas de fezes de crianças entre 0-5 anos das cidades de São Luís e Macapá. 3.2. OBJETIVOS ESPECÍFICOS Identificar os possíveis marcadores de virulência nos isolados; Caracterizar a atividade hemolítica; Avaliar o tipo de fímbrias e a produção de biofilme; Determinar o perfil de resistência antimicrobianos; Detectar a presença de ESBL 23 4. METODOLOGIA 4.1. População estudada De abril de 2009 a março de 2010 amostras de fezes de 204 crianças (até cinco anos de idade) foram coletadas como parte de um estudo de caso e controle realizado nas cidades de São Luís e Macapá, Brasil. Casos foram caracterizados como crianças que apresentaram 3 ou mais evacuações em período de 24 horas de fezes pastosas ou líquidas. O grupo controle foi caracterizado como crianças que não apresentavam qualquer sintoma gastrointestinal de pelo menos 30 dias anterior a inclusão nesta pesquisa. O estudo global de caso-controle consistia de 102 casos e 102 controles. 4.2. Identificação do patógeno Amostras de fezes coletadas em meio transporte Cary-Blair foram cultivadas em meio agar MacConkey para selecionar isolados de E. coli. Colônias com morfologia presumidamente de E. coli foram selecionadas e submetidas a testes bioquímicos. Isolados de E. coli foram estocados a -80ºC em infusão de cérebro e coração (BHI) com 20% de glycerol para posterior procedimentos. Os isolados de EAEC e EPEC atípica são apresentados, segundo sua região de origem (São Luís ou Macapá), na tabela abaixo. 24 Tabela 1. Linhagens bacterianas estudadas neste trabalho Linhagem Identificação Laboratorial Origem A2 Macapá A 17 São Luís A3 Macapá A 16 São Luís A7 São Luís EAEC A 10 São Luís A5 São Luís A 19 São Luís A 15 Macapá A 14 São Luís A9 Macapá EPEC Atípica A 12 A1 A4 A6 A 18 A 11 A8 A 13 Macapá Macapá Macapá São Luís São Luís Macapá Macapá Macapá 4.3. Identificação molecular das categorias patogênicas de Escherichia coli e seus marcadores de virulência Foram analisadas, em média, 4 isolados bacterianos identificados bioquimicamente como E. coli em cada amostra de fezes. As bactérias foram submetidas, inicialmente, à técnica de reação em cadeia da polimerase (PCR). A pesquisa incluiu a detecção dos seguintes genes ou regiões conservadas de DNA, para análise do tipo de linhagem de E. coli diarreiogênica: eae (para EPEC e EHEC), stx1 e stx2 (para EHEC), elt e est (para ETEC), ipaH (para EIEC) e aggR (para EAEC) (TOMA et al., 2003). Para tanto utilizou-se como cepas diarreiogênicas padrões os seguintes isolados: EPEC 2348/69; EHEC EDL933; ETEC H1 0407; 25 EIEC 223-83; e EAEC 042. No entanto só foi utilizado neste estudo as linhagens EAEC e EPEC. As colônias eae+ e stx- foram pesquisadas para a presença do gene bfpA (que codifica a pilina da fímbria Bundle Forming Pilus) para a discriminação dos subgrupos de EPEC (típicas, portadoras de bfpA e atípicas, desprovidas desse gene). Também foi empregada neste estudo a pesquisa de outros marcadores de virulência, que codificam: beta-lactamases de espectro estendido (ESBL), Toxina citoletal distensora (cdt) e o sideróforo yersiniabactina (irp). Os primers utilizados estão relacionados na tabela 2. Para tanto, a extração de DNA foi realizada após crescimento bacteriano em Agar nutriente por 24 horas a 37ºC, na qual os isolados crescidos foram colocados em tubos de Eppendorff com água destilada estéril e deixados por 5 a 10 minutos em água em ebulição. O DNA foi verificado através do sistema de eletroforese horizontal submerso. A concentração do gel utilizado variou entre 1% a 2,5%. A agarose foi infundida em tampão Tris-borato EDTA (TBE) 0,5X, resfriada e vertida em uma cuba contendo sobre a mesma um pente de acrílico para a formação das canaletas. Após o endurecimento, o gel foi transferido para a cuba de eletroforese horizontal submarina contendo tampão TBE 0,5X e as amostras de DNA aplicadas nas canaletas. A voltagem utilizada foi de 70V. Após o término da corrida, o gel foi transferido para cuba contendo solução de brometo de etídio (2,5µg/ml) e o DNA foi visualizado sob luz violeta. 26 Tabela 2. Primers usados para identificar deiferentes fatores de virulência de Escherichia coli enteroagregativa e enteropatogênica. Gene Fator de virulência aggR Fator de transcripção cdt toxina distensora citoletal bfpA Bundle-forming pili eae Intimina elt toxina termo lábil est Toxina termo estável set1A Shigella enterotoxin-1 stx Verotoxina irp2 yersinabactina bla TEM bla CTX-M Beta-lactamses de espectro estendido Tamanho de Referência amplificação GTATACACAAAAGAAGGAAGC ACAGAATCGTCAGCATCAGC GAAARTAAATGGAAYAYAMATGTCCG AATCWCCWRSAATCATCCAGTTA ATTGAATCTGCAATGGTGC ATAGCAGTCGATTTAGCAGCC CCCGAATTCGGCACAAGCATAAGC CCCGGATCCGTCTCGCCAGTATTCG TCTCTATGTGCATACGGAGC CCATACTGATTGCCGCAAT TTAATAGCACCCGGTACAAGCAGG CCTGACTCTTCAAAAGAGAAAATTAC TCACGCTACCATCAAAGA TATCCCCCTTTGGTGGTA GAGCGAAATAATTTATATGTG TGATGATGGCAATTCAGTAT AAGGATTCGCTGTTACCGGAC 254 466 461 881 322 147 309 518 264 TCGTCGGGCAGCGTTTCTTCT TCGCCGCATCACACTATTCTCAGAATGA 445 ACGCTCACCGGCTCCAGATTTAT ATGTGCAGYACCAGTAARGTKATGGC 593 TGGGTRAARTARGTSACCAGAAYCAGCGG (TOMA et al., 2003) (TOTH et al., 2003) (ROBINSBROWNE et al., 2004) (TOMA et al., 2003) (TOMA et al., 2003) (TOMA et al., 2003) (VILA et al., 2000) (TOMA et al., 2003) (CZECZULI N et al., 1999) (MONSTEI N et al., 2007) (MONSTEI N et al., 2007) 27 bla SHV ATGCGTTATATTCGCCTGTG 747 TGCTTTGTTATTCGGGCAAA AAGGTGTTACAGAGATTA 268 efa1 Fator de aderência da EHEC hlyEHEC Enterohemolisina GCATCATCAAGCGTACGTTCC 534 iha Adesina homóloga a irgA AATGAGCCAAGCTGGTTAAGCT CAGTTCAGTTTCGCATTCACC GTATGGCTCTGATGCGATG 1305 TGAGGCGGCAGGATAGTT (MONSTEI N et al., 2007) (NICHOLL S, GRANT, ROBINSBROWNE, 2000) (PATON, PATON, 1998) (TOMA et al., 2004) 28 4.3. Detecção da atividade hemolítica 4.3.1. Pesquisa da atividade hemolítica em meio sólido Para a pesquisa de hemolisina em ágar sangue as linhagens de Escherichia coli foram cultivadas em infusão de cérebro e coração (BHI) a 37°C por 24 h em cultivo estacionário. Após o crescimento bacteriano,as linhagens foram semeadas sobre e em profundidade em ágar Muller Hinton contento 5% de hemácias: humana (A,B e O), carneiro e cavalo lavadas com tampão fosfato salina (PBS) com ph de 7,4 (BEUTIN et al., 1988). A título de comparação foi utilizado estes tipos sanguíneos sem a utilização de PBS. A presença de halos de hemólise ao redor ou sob as colônias foi observada após 3, 6 e 24 h. Como controle positivo foi utilizada a linhagem de Pseudomonas aeruginosa. 4.3.2. Pesquisa da atividade hemolítica no sobrenadante da cultura Alíquotas de 500µL de sobrenadante das culturas de Escherichia coli em BHI a 37°C foram centrifugadas três vezes (3000 Xg,15 min), sendo diluídas na razão 2, em PBS com ph 7,4. Uma alíquota de 500 µL de suspensão a 1% de hemácias de carneiro, previamente lavadas três vezes em PBS com ph 7,4, foi adicionada a cada orifício contendo os sobrenadantes dos cultivos bacterianos. Foi incubado à 37°C por uma hora para posterior análise por espectrofotometria com densidade óptica de 540nm (BHAKDI et al., 1986). 29 4.3.3. Pesquisa de hemólise de contato As bactérias foram lavadas duas vezes e suspendidas em PBS com ph 7,4 para uma concentração de 2 X 1010 CFU/ml. O contato íntimo entre a bactéria (50μl) e solução de eritrócitos a 1% (50μl) foi realizado por centrifugação a 3000 Xg por 20 minutos. Então incubou-se a 37ºC por 3 horas. Após este período adicionou-se 120μl de PBS frio e centrifugou-se a 2200 Xg por 20 minutos. 100μl de cada sobrenadante foram transferidos para microplaca. Densidade óptica a 540nm foi medida por espectrofotometria (SANSONETTI et al., 1986). 4.4. Infulência da presença de íons, quelantes, protetores osmósticos e soro na atividade da hemolisina 4.4.1. Cultivo na presença de agentes quelantes e íons Para verificar a influência de agentes quelantes as linhagens de Escherichia coli foram cultivadas em BHI contendo separadamente os quelantes etilenodiamina-tetra ácido acético (EDTA) a 10mM e etileno-di (ohidroxifenol) ácido acético (EDDA) na concentração de 12,5 µg/ml (BHUIYAN, RAHMAN, HAIDER, 1995). As amostras também foram crescidas na presença de cloreto de ferro, cloreto de níquel, cloreto de magnésio, cloreto de cálcio nas concentrações de 10mM. Estes testes foram realizados tanto em placa como em meio líquido, vistos em 4.3.1. e 4.3.2. respectivamente. 30 4.4.2. Teste de hemólise com protetores osmóticos Este experimento foi realizado segundo a metodologia descrita por Bhakdi et al (1986) com algumas modificações. A atividade da hemolisina foi testada com suspensão de carneiro (1%) em PBS contendo 30mM dos seguinte carboidratos: frutose, galactose, sacarose e rafinose. 4.4.3. Inibição da atividade hemolítica por soro A hemolisina foi incubada a 37°C por 30 min na presença de soro humano normal na razão 2 em PBS. A atividade hemolítica foi testada em microplaca (item 4.3.2) imediatamente após este tratamento. 4.5. Produção de biofilme 4.5.1. Produção de biofilme em Ágar Vermelho Congo Meio de cultura constituído de caldo infusão cérebro-coração 37g/L, sacarose 50g/L, ágar 10g/L e corante Vermelho Congo 0,8g/L. O corante vermelho Congo foi preparado como solução aquosa concentrada, autoclavado separadamente a 121°C por 15 minutos, sendo adicionado ao ágar quando este atingiu a temperatura de 55ºC. Os isolados foram semeados sobre o meio por esgotamento com alça bacteriológica, incubados em aerobiose a 35-37°C por 24 horas e após, deixados em temperatura ambiente por mais 18 horas. As amostras que apresentaram colônias quase enegrecidas foram consideradas como produtores moderados de biofilme e colônias negras foram considerados como fortes produtores de biofilme (FREEMAN, FALKINER, KEANE, 1989). 31 4.5.2. Produção de biofilme em microplaca Realizado através dos cultivos em BHI, 24 horas após a inoculação a 37ºC. Logo após, uma porção de cada cultivo foi diluída à 1:40 em meio BHI estéril. Cada amostra, já padronizada, foi adicionada em placas de cultura de tecido com 96 cavidades com fundo em “U”, em triplicata, junto com controles, no volume de 200 µL/cavidade. Após preenchidas, as placas foram incubadas à 37°C por 24h em estufa microbiológica. Passado o tempo de incubação, as placas foram lavadas por três vezes com tampão PBS com ph 7,4, e deixadas secar à temperatura ambiente. Nas placas secas adicionou-se Cristal Violeta 200 µL /cavidade por 15 min à temperatura ambiente. Após, cada cavidade foi lavada com água destilada estéril por três vezes, e deixadas secar à temperatura ambiente. As placas coradas com cristal violeta foram submetidas a espectrofotometria com filtro de 470ηm para aferir as respectivas absorbâncias de cada cavidade. Baseando-se nas densidades ópticas (D.O.i) produzidas pelos isolados, e tomando-se por base o controle negativo (D.O.c) os isolados foram classificados nas seguintes categorias (STEPANOVIC et al., 2004): • Não produtor: D.O.i < D.O.c • Produtor Fraco: D.O.c < D.O.i ≤ (2X D.O.c) • Produtor Moderado: (2X D.O.c) < D.O.i ≤ (4X D.O.c) • Produtor Forte: (4X D.O.c) < D.O.i 32 4.6. Identificação de fímbrias 4.6.1. Identificação da fímbria curli A cultura foi crescida a 37ºC no meio Luria Bertani (LB), com ph 8, durante 24 horas. Depois de crescido a cultura foi semeada em placas de LB (sem sal) contendo 0.004% de Vermelho Congo e 0.002% de Azul Brilhante. As placas foram incubadas por 24 a 48 horas em temperatura ambiente. Colônias vermelhas ou rosas são indicativas de bactérias produtoras de curli (DA RE, GHIGO, 2006). 4.6.2. Identificação da fímbria tipo I Realizado através dos cultivos em BHI por 24 horas a 37ºC. Logo após, uma porção de cada cultivo foi centrifugada três vezes (3000xg por 15 minutos), sempre descartando o sobrenadante e colocando PBS com ph 7,4. Cerca de 500µl dos isolados foram misturados, em lamínulas de vidro, com 500µl de sangue lavado três vezes com PBS, com e sem adição de manose. As amostras que produziram hemaglutinação, somente, na ausência de manose foram consideradas positivas para fímbria tipo I (CLEGG, OLD, 1979). 4.7. Resistência ao soro Para identificar os isolados de E. coli resistentes ao soro foi seguida a seguinte metodologia (PELKONEN, FINNE, 1987), com algumas modificações. Foi obtido soro humano na coleta de sangue de 10 adultos imunocompetentes. O soro foi congelado a -86ºC até o uso. Foram obtidas três formas de soro a serem desafiados contra os isolados em análise: 1) soro inativado, considerando sem atividade do sistema 33 complemento, obtido por incubação por 30 minutos a 56ºC; 2) soro tratado com Etilenodiamina-tetra ácido acético (EDTA) na concentração de 10mM, para inibir a atividade do complemento pela via clássica e alteranativa e por último; 3) soro normal sem quaisquer tratamento. Após a reativação dos isolados em caldo de infusão de cérebro e coração (BHI), 500µl de cada cultura foram adicionados a 4,5ml de BHI, e incubados por 90 minutos a 37ºC. Após esta etapa, as culturas foram centrifugadas a 1500Xg por 15 minutos. O sobrenadante foi descartado e três ml de PBS ph 7,4 foram adicionados para ressuspender o sedimento. A resistência ao soro foi analisada usando placas de microtitulação em fundo chato por espectrofotometria. Para a realização do teste 120µl de PBS foram colocados nos primeiros dois orifícios da microplaca e 120µl da suspensão bacteriana nos subseqüentes. Foram adicionados 60µl de soro, para uma concentração final de 33% nos orifícios da microplaca, sendo incubada a 37ºC. A absorbância em comprimento de onda de 470ηm foi mensurada nos seguintes tempos após a adição do soro: 0, 30, 60, 90 e 120 minutos. Cada isolado foi testado em triplicata para soro normal, tratado com EDTA e soro inativado. O isolado que reduziu a absorbância inicial para valores inferiores a 50% foi considerado sensível. Foram considerados resistentes os isolados que apresentaram fração sobrevivente superior a 90%, e os que ficaram entre estes dois valores foram considerados intermediários. 34 4.8. Teste de resistência aos antimicrobianos O teste de resistência aos antimicrobianos foi realizado segundo a metodologia de difusão com discos (BAUER et al., 1966). As culturas obtidas foram diluídas em escala seriada decimal até atingir a concentração estimada de 3X105 UFC/ml. Em seguida, com auxílio de um “swab” estéril, uma alíquota da cultura foi espalhada sobre toda superfície das placas Petri contendo 50ml de Müller-Hinton, para se obter um inoculo uniforme e homogêneo. Após dois minutos, discos de antimicrobianos foram posicionados na superfície do ágar em posições eqüidistantes, e as placas foram incubadas a 37ºC por 18 horas. Após incubação, os diâmetros dos halos de inibição do crescimento foram mensurados. Para interpretação das medidas dos halos, foram considerados os padrões de resistência e sensibilidade para bactérias Gram-negativas do Clinical and LaboratoryStandards Institute. Foram utilizados os seguintes antibióticos: ampicilina (10μg), cefalotina (30μg), ceftazidima (30μg), ampicilina + sulbactam (10/10μg), sulfametaxazol + trimetoprim, tircacilina + ácido clavulânico (75/10μg), cefuroxima (30μg), imipenem (10μg), aztreonam (30μg), piperacilina + tazobactam (100/10μg), gentamicina (10μg), ceftriaxona (30μg). 4.9. Análise estatística Para análise de resistência ao soro foi utilizado ANOVA. Na avaliação da presença dos fatores de virulência e as respectivas combinação entre os fatores de virulência, empregou-se regressão logística múltipla. Já a associação da presença de algum gene codificador de beta-lacatamase de espectro estendido e resistência a vários tipos de antibióticos, foi empregado 35 coeficiente de Contingência C. estatisticamente significativo. O valor de p<0,05 foi considerado 36 5. RESULTADOS 5.1. Detecção da atividade hemolítica 5.1.1. Pesquisa de hemolisina Das 19 amostras de Escherichia coli examinadas, 4 (21%) apresentaram halo de hemólise ao redor das colônias em meio sólido. A presença de halo começou a evidenciar-se após 6 horas, em dois isolados, e 24 horas de incubação nos outros dois isolados hemolíticos (tabela 3). Foi visualizado hemólise em todos os tipos de sangue, exceto por um isolado que não apresentou atividade hemolítica no sangue humano tipo B e outro em sangue de cavalo, o que não representou diferença da atividade hemolítica para o tipo de sangue utilizado (p>0,05). O meio preparado com hemácias lavadas não alterou o padrão de hemólise (dados não demonstrados). Quando testou-se o íntimo contato dos isolados hemolíticos com eritrócitos de carneiro verificou-se que o isolado A19 apresentou hemólise total (99%) e os isolados A 15 e A 18 apresentaram hemólises similares,72% e 73% respectivamente. Apenas o isolado A 11 não apresentou tal atividade (dados ao demonstrados). 37 Tabela 3 . Expressão de hemolisina de Escherichia coli em placas de MullerHinton-sangue, com diferentes hemácias, observada em diferentes tempos (horas) de cultivo. Humano Carneiro Cavalo Linhagem Identificação O B 3 6 24 3 6 24 3 6 24 3 6 24 EAEC A 16 - - - - - - - A 14 - - - - - - - A5 - - - - - - - A 19 - - + - + - - - + A 17 - - - - - - - A7 - - - - - - - A 10 - - - - - - - A2 - - - - - - - A 15 - + + - + - + + - + + A9 - - - - - - - A3 - - - - - - - EPEC atípica A6 A 18 A4 A1 A 12 A 13 A 11 A8 - + - + + - - - + + - - + - + + - - - + - 5.1.2. Influência de diferentes condições de cultivo na atividade hemolítica O quelante de ferro (EDDA), cloreto de ferro e cloreto de cálcio não alteraram a atividade hemolítica das amostras analisadas, entretanto a presença d o quelante de cálcio (EDTA) inibiu esta atividade quando testados em meio sólido (tabela 4). Deste modo pode-se notar que a constituição do meio interfere na atividade hemolítica (p<0,05). O mesmo foi observado quando os isolados foram testados em meio líquido, como demonstrado na figura 1. Verificou-se que a atividade hemolítica no meio de cultura acrescido de EDDA e cálcio foi maior com média de 84% e 81% respectivamente, 38 apresentando valores similares ao meio de cultura puro (p>0.05). Os meios de cultura acrescidos de níquel, magnésio e ferro apresentaram atividade hemolítica com índices menores que meio puro, com média de 66%, 54%, 65%, respectivamente. Entretanto tal diminuição não apresentou diferença estatisticamente significativa (p>0.05). Por outro lado, observou-se que o acréscimo de EDTA ao meio de cultura causou uma diminuição da atividade hemolítica (29% de hemólise) em relação ao meio de cultura puro. Entretanto no que diz respeito do tipo de linhagem, EPEC atípica e EAEC, e a constituição do meio, demonstrou-se que não há interferência destes fatores com a atividade hemolítica (p>0.05), como demonstrado na tabela 4. Dos carboidratos utilizados nenhum efetivamente protegeu contra atividade hemolítica. 39 Tabela 4. Atividade hemolítica de isolados de EAEC e EPEC atípica em sangue de carneiro com diferentes constituintes de cultivo Quelantes Íons Linhagem Identificação EDTA EDDA Fe3+ Ca2+ EAEC A 16 A 14 A5 A 19 + + + A 17 A7 A 10 A2 A 15 + + + A9 A3 EPEC atípica A6 A 18 A4 A1 A 12 A 13 A 11 A8 - + + - + + - + + - Carboidrato (Diâmetro molecular em nm) Fru Gal Sac Raf (0,72) (0,72) (0,9) (1,2 - 1,4) + + + + + + + + + + + + + + + + - EDDA - Etileno-di (o-hidroxifenol) ácido acético; EDTA - Etilenodiamina-tetra ácido acético. Fru- frutose; Gal Galactose; Sac - sacarose; Raf - rafinose 40 5.2. Produção de biofilmes Dependendo da metodologia empregada, houve variação entre as categorias dos isolados categorizados como produtores de biofilme, mas estes métodos se apresentam similares (p>0,05). Pode ser visto na tabela 5, que 31% dos isolados analisados por Ágar Vermelho Congo não foram produtores de biofilme, freqüência relativa maior que na metodologia por espectrofotometro. Segundo o método em microplaca, aproximadamente 26% não foram produtores de biofilme; 37% se apresentaram como fortes produtores, 10% moderados produtores e 26% foram considerados como fracos produtores de biofilme, como pode ser visto na figura 2. 41 5.3. Identificação de isolados produtores de fímbrias: curli e fímbria tipo I Dos isolados testados apenas 4 (21%) não apresentaram a fímbria curli, sendo todos pertencentes a linhagem EAEC. Contudo apenas esta linhagem apresentou fímbria tipo I (3 amostras). Não houve associação entre a presença da fímbria curli com a produção nem com o grau de produção de biofilme (p>0,05). 42 Tabela 5. Presença de curli, Fímbria tipo I e Produção de Biofilme entre os isolados de EAEC e EPEC atípica Biofilme* Linhagem Identificação EAEC EPEC atípica Hemaglutinação curli AVC ESP HMR HMS A 16 ++ ++ - - + A 14 +++ +++ + - - A5 ++ - + - + A 19 +++ +++ - - + A 17 +++ +++ + - - A7 ++ + - + + A 10 - - - + + A2 +++ - + - - A 15 - - - - - A9 +++ + - + + A3 - + - - + A6 +++ + - - + A 18 +++ +++ + - + A4 ++ +++ + - + A1 +++ + + - + A 12 ++ ++ - - + A 13 - - + - + A 11 - +++ + - + A8 - +++ + - + AVC - Ágar Vermelho Congo; ESP - espectofotometria; HMR - hemaglutinação manose resistente; HMS hemaglutinação manose sensível (fímbria tipo I). * - = não produtor de biofilme; + = biofilme fraco; ++ = Biofilme moderado; +++ = Biofilme forte. 5.4. Caracterização dos marcadores de virulência e presença de beta-lactamases de espectro estendido entre os isolados Na análise genotípica, realizada pela técnica PCR, acerca da distribuição de ESBL (Tabela 6), notou-se que os isolados de EAEC apresentaram uma freqüência relativa altíssima para algum gene responsável 43 pela produção de beta-lactamase (72%), enquanto os isolados de EPEC atípica essa presença teve uma leve diminuição (50%). É importante ressaltar que o gene mais prevalente foi o bla TEM, presente em sete isolados de EAEC e três em EPEC atípica (53%); acompanhado do bla CTX-M, 2 em EAEC e 1 em EPEC atípica (16%). Tabela 6. Distribuição de beta-lactamases de espectro estendido (ESBL) entre os isolados de EAEC e EPEC atípica. ESBL Linhagem EAEC Identificação Laboratorial A2 A 19 A3 A 16 A7 A 10 A5 A 17 A 15 A 14 A9 EPEC atípica A4 A1 A 12 A6 A 18 A 11 A8 A 13 bla CTX-M + + + - bla TEM + + + + + + + + + + bla SHV - Em contraposição que estes achados, a distribuição de marcadores de virulência, vistos na tabela 7, se mostrou tímida; haja visto que somente duas amostras (10%) apresentaram sideróforo yersiniabactina e uma (5%) a adesina iha, todas pertencentes a EPEC atípica. Apenas uma amostra apresentou a combinação de gene responsável pela produção de beta-lactamases e um 44 marcador de virulência (irp e bla TEM). Vale ressaltar que todos os isolados de EPEC atípica foram considerados como atípicos devido a ausência do marcador bfp. Tabela 7. Distribuição de marcadores de virulência entre Escherichia coli enteroagregativa e enteropatogênica atípica. Adesinas Toxina Sideróforo Identificação bfp efa-1 iha cdt hlyEHEC irp Linhagem Laboratorial EAEC A2 A 19 A3 A 16 A7 A 10 A5 A 17 A 15 A 14 A9 EPEC atípica A4 A1 A 12 A6 A 18 A 11 A8 A 13 - - + - - - + + bfp – bunding forming pilus; cdt – citolethal distending toxin; irp- Yersiniabactin biosynthesis gene, efa-1- EHEC fator para aderência; iha –adesina homóloga a irgA; ehx enterohemolisina. 5.5. Resistência aos antimicrobianos Embora o teste de fenotipagem da suscetibilidade dos isolados de E. coli demonstrar que cerca de 42% dos antibióticos foram eficazes em inibir o crescimento de todos os isolados testados, 40% destes eram beta-lactâmicos associados com protetores contra a ação das enzimas beta-lactamases (Tabela 8). 45 Como pode-se notar nos dados mencionados no item anterior, e que comprova-se com o teste fenotípico, a ação das beta-lactamases conferem resistência aos isolados. Isto é demonstrado na tabela 8, na qual houve diminuição da freqüência relativa de isolados resistentes a ampicilina quando comparados com este medicamento em associação com com sulbactam, protetor da ação das beta-lactamases, 58% para 0% respectivamente (p< 0.05). Por outro lado não foi possível determinar qualquer correlação entre a presença dos genes responsáveis pela produção de beta-lactamases e o tipo de antibiótico ao(s) qual(is) era(m) resistente(s) (p>0,05), o que pode denotar uma possível heterogenicidade ou, melhor ainda, presença de algumas subclasses destas enzimas para o determinado gene encontrado. 46 Tabela 8. Perfil de sensibilidade a antimicrobianos dos isolados de EAEC e EPEC atípica. Antibióticos Identificação Linhagem laboratorial AMP KF CAZ SAM SXT TIM CXM IPM ATM TZP CN CRO EPEC atípica A1 S R S S S S S S S S I S A4 S R S S S S S S S S S S A6 S R S S S S S S S S R S A8 A11 A12 A13 A18 S R S S R R R R R R S S S S S S S S S I R S S R R S S S S R S S S S I S S S S S S S S S S S S S S S EAEC A2 S R S S R S S S S S A3 R R S S S S S S S S A5 S R S S S S S S S S A7 R R S S S S S S S S A9 I R S S S S S S S S A10 I R S S R S S S S S A14 S I S S R S S S S S A15 S S R S S S S S R S A16 R R S S R S S S S S A17 R R S S R S S S S S A19 R R S S R S S S S S AMP – ampicilina; KF – cefalotina; CAZ – ceftiazidima; SAM – ampicilina + sulbactam; SXT – sulfametaxazol + trimetoprim; TIM – tircacilina + ácido clavulânico; CXM – cefuroxima; IPM – imipenem; ATM – aztreonam; TZP – piperaciclina + tazobactam; CN – gentamicina; CRO – ceftriaxona. S – sensível; I – indeterminado; R – resistente. Interessante notar que os isolados positivos para algum tipo de gene responsável pela produção de beta-lactamases, avaliados neste estudo, apresentaram ampla resistência a vários tipos de antibióticos quando, comparados aos não produtores (tabela 7 e 8), principalmente pela presença do gene bla TEM, já que 38% dos isolados que apresentavam tal gene tiveram um perfil de resistência em três ou mais tipos de antibióticos testados. S S S S S S S S S S R S S S S S S S S S S S S S S S S S S S S S 47 5.6. Resistência ao soro Pode-se verificar nas figuras 3A, 3B e 3C; que as taxas de crescimento entre os isolados de EAEC e EPEC atípica não diferem nos soros analisados (humano normal, soro tratado com EDTA e no soro inativado por aquecimento), tão pouco há diferença entre os períodos de incubação (p> 0.05). Contudo há diferença da taxa de crescimento no soro humano normal (figura 3A) com os outros dois analisados (figuras 3B, 3C), tanto nos isolados de EAEC quanto nos isolados de EPEC atípica (p<0.05). Isto é corroborado com a constatação de que apenas um isolado (5%) foi considerado sensível, sendo pertencente a linhagem EPEC atípica; quatro (21%) intermediários, uma EPEC atípica e três EAEC; e 14 (74%) resistentes a ação do soro humano normal in vitro (figura 3A). No soro tratado com EDTA (figura 3B), pode-se notar que esta freqüência foi alterada, já que 18 (95%) dos isolados foram considerados resistentes, com sua taxa de crescimento sendo influenciada pela ausência de atividade da via clássica e alternativa do sistema complemento (p<0,05). No entanto os isolados tidos como resistentes tiveram um maior crescimento no soro humano normal que no soro tratado com EDTA (p<0,05). As curvas de crescimento das cepas no soro tratado com EDTA e no soro inativado foram similares (p>0,05), apesar dos primeiros 30 minutos de incubação o crescimento dos isolados em soro com EDTA foi bem superior (dados não demonstrados). É importante mencionar que nem a presença de produtores fortes de biofilme nem a presença da fímbria curli tiveram associação com esta resistência (p>0,05). 48 49 5.7. Prevalência entre marcadores e fatores de virulência dos isolados de EAEC e EPEC atípica A distribuição dos diferentes fatores de virulência foi bastante heterogênea, com 12 (63%) isolados apresentando quatro ou mais fatores de virulência. Neste estudo, a mais frequente combinação foi: produção de biofilme, curli, resistência ao soro (15,7%); resistência ao soro (10,5%); bla CTX, produção de biofilme, curli, bla TEM, produção de biofilme, curli, resistência ao soro e hemólise (10,5%); blaTEM, curli, resistência ao soro (10,5%) (tabela 9). Pode-se notar, também, que as cepas de EAEC não apresentaram repetição aos mesmos fatores em isolados diferentes, ao contrário do que pode ser visto nas cepas de EPEC atípica (dois isolados). Não houve associação entre o tipo de linhagem e a presença de algum destas propriedades de virulência (p>0,005). É importante salientar que as cepas hemolíticas foram as mais virulentas, pois as mesmas apresentaram pelos menos cinco dos 11 fatores e marcadores de virulência testados, sempre apresentando produção de biofilme e resistência ao soro, além de três entre as quatro cepas hemolíticas são produtoras de β-lactamases de espectro estendido. 50 Tabela 9. Frequência relativa e absoluta dos fatores de virulência, marcadores e genes responsáveis pela produção de beta-lactamases de espectro estendido (ESBL). EAEC nº EPEC atípica nº Total nº Fatores de Virulência (%) (%) (%) Resistência ao soro 8 (72,7%) 6 (75%) 14 (73,6%) Biofilme 9 (81%) 6 (75%) 15 (78%) curli 7 (63,6%) 8 (100%) 15 (78%) Fímbria tipo I 3 (27,2%) 0 (0%) 3 (15,7%) Hemólise 2 (10,5%) 2 (25%) 4 (21%) Marcadores de virulência irp 0 (0%) 2 (25%) 2 (10,5%) iha 0 1 (12,5%) 1 (5,25%) ESBL bla TEM 7 (63,3%) 3 (37,5%) 10 (52,6%) bla CTX-M 2 (10,5%) 1 (12,5%) 3 (15,7%) 51 6. DISCUSSÃO Escherichia coli tem se destacado como um importante agente de diarréia infecciosa, principalmente em crianças. A patogenicidade das linhagens diarreiogênicas está possivelmente associada a diversos fatores de virulência, por exemplo, produção de biofilme, expressão de fímbrias, produção de hemolisinas, resistências antimicrobianos e ao soro (ELIAS et al., 2002; TRABULSI et al., 2002). A adesão e, posterior, produção de biofilme tem sido demonstrado como sendo um fator primordial para que uma linhagem bacteriana inicie sua infecção. A habilidade para formar biofilme está intimamente relacionadas à persistência e virulência bacteriana (FERRIERES et al., 2007a; HARRISON et al., 2009). A adesão pode ser realizada através de diversas fímbrias, dentre elas o curli que tem um importante papel na patogenicidade. Sugere-se que a fímbria curli tem a função de promover a autoagregação entre bactérias, além de facilitar invasão e colonização (DYER et al., 2007). Outros estudos realizados demonstraram que as cepas que possuíam tal estrutura eram mais virulentas que cepas que não possuíam (UHLICH, KEEN, ELDER, 2002; UHLICH, COOKE, SOLOMON, 2006). Entretanto constatou-se que não houve relação da produção de biofilme com a expressão da fímbria tipo I e a curli pois apesar de 73% dos isolados estudados produzirem biofilme, somente três isolados apresentaram somente fímbria tipo I e fímbria curli (pertencentes a linhagem EAEC) e doze apresentaram somente fímbria curli (8 EPEC atípicas e 4 EAEC). Os resultados 52 sugerem, também, que a presença de outras fímbrias pois dez cepas analisadas apresentaram hemaglutinação manose resistente. Quanto à produção de hemolisina, várias pesquisas concluíram que isolados que apresentavam a capacidade de produção desta toxina eram visivelmente mais virulentas do que os isolados não-hemolíticos (COOKSON et al., 2007; HUNT et al., 2008). Tais dados são confirmados neste estudo, já que todos os quatro isolados com atividade hemolítica apresentaram o maior número de propriedades de virulência em relação às outras cepas. Estes isolados apresentaram resistência ao soro, com média de 134%, demonstraram genes codificadores de beta-lactamases, e uma atividade hemolítica de contato com características diferentes da enterohemolisina. Este fato pode ser comprovado pela não amplificação do gene responsável pela produção da enterohemolisina bem como, testes fenotípicos pois não houve diferenciação na a expressão da hemolisina de contato na presença de sangue lavado e não lavado. A enterohemolisina é mencionada por alguns autores como uma enterotoxina, relacionada com hemolisina, codificada pelo mesmo plasmídio responsável bundle-forming fimbriae, no qual é associado com a aderência agregativa da EAEC, na qual ela só é liberada no meio externo após íntimo contato entre a bactéria e o eritrócito (BALDWIN et al., 1992; NATARO et al., 1992; HAQUE et al., 1994) A análise da presença de diferentes constituintes no meio de cultura para detectar interferências na ação da hemolisina, verificou-se que o uso de quelante de ferro (EDDA) e cloreto de cálcio foram capazes de aumentar a atividade hemolítica, ao contrário do uso de EDTA, que inibiu tal atividade. Esta 53 última característica demonstra uma propriedade da α-hemolisina, já que esta necessita do cálcio para a estabilização e formação de poros em membranas biológicas (DOBEREINER et al., 1996; VALEVA et al., 2008). Pode ser visto também que o soro não afetou a ação da hemolisina, pois não houve diferença deste com o meio de cultura puro. De outro lado, os meios com íons níquel e magnésio diminuíram a ação da hemolisina. Estes dados corroboram com os achados de outro estudo, na qual faz menção que cátions divalentes apresentam um efeito ambíguo na ação desta toxina (DOBEREINER et al., 1996). Uma das prováveis explicações para o fato seria que outros cátions não suportam a atividade lítica da toxina e não se ligam a resíduos da hemolisina dentro da região formadora do poro (SCHINDEL et al., 2001). De outro lado, como a hemolisina não apresenta um receptor específico e meios alcalinos apresentam pequena quantidade de cálcio em sua composição a redução da hemólise não foi tão drástica quanto a observada no meio tratado com EDTA. Uma característica patogênica importantíssima à virulência de linhagens de E. coli, associada a atividade hemolítica, é a capacidade de produção de sideróforo. Esta estrutura possibilita que as bactérias obtenham ferro, necessário a sua sobrevivência, a partir das células do hospedeiro. Recentes estudos têm demonstrado que algumas cepas patogênicas de Escherichia coli apresentam ilhas de patogenicidade originalmente encontradas em Yersinia spp que codificam o sideróforo yersiniabactina (KOCZURA, KAZNOWSKI, 2003; HANCOCK, FERRIERES, KLEMM, 2008). 54 Os resultados da análise dos 19 isolados de Escherichia coli demonstraram que dentre estas, 2 apresentaram yersiniabactina. Se dentre estas linhagens que apresentaram tal propriedade, apenas um isolado tinha atividade hemolítica, o que diverge destes estudos mencionados acima. Um mecanismo importante para a sobrevivência dos microorganismos no hospedeiro é a de burlar as linhas de defesa do sistema imunológico. Estes agentes têm usado várias estratégias com esta finalidade como atividade hemolítica e leucotóxica, expressão de proteína M, antígeno O do lipossacarídeo, cápsula contendo resíduos de ácido sialicílico e a captura de inibidores do sistema complemento para então inativá-lo (MUSHTAQ et al., 2004; WOOSTER et al., 2006; MARUVADA, BLOM, PRASADARAO, 2008). Como pode ser visto neste trabalho, a maioria dos isolados testados foram resistentes a incubação com soro humano normal. Interessantemente as cepas que apresentaram uma sobrevivência acima de 90% em duas horas de incubação. Uma das justificativas, para esses dados, seria que os isolados de E. coli resistem a atividade bactericida do soro mais eficientemente devido a diminuição da deposição de proteínas do sistema complemento e subseqüente formação de complexo de ataque a membrana e lise (MARUVADA et al., 2008). Prévios estudos relatam que proteínas de membrana externa da E. coli, principalmente OmpA, interagem com moléculas do sistema complemento medeiando a degradação de C3b e C4b, o que culmina na evasão da atividade bactericida do soro, evitando a via clássica e alternativa do sistema complemento (PRASADARAO et al., 2002; WOOSTER et al., 2006). 55 Notou-se, também, quando a via alternativa e a via clássica foram inibidas com a presença de EDTA, os isolados que foram considerados como resistentes intermediários no soro normal, obtiveram um maior crescimento, sendo caracterizadas como resistentes. Este dado pode ser explicado pelo fato de que a ligação da lectina manose-ligante (MBL) à Escherichia coli é diminuída na presença de EDTA (SHIRATSUCHI et al., 2008). Contudo esta via necessita do componente C4 e, como foi visto acima, esta bactéria apresenta mecanismos para burlar este caminho. Outra forma importante de sobrevivência bacteriana é demonstrada pela resistência susceptibilidade a a antimicrobianos. ampicilina e Este estudo trimetoprim foi demonstrou apreciável e que a que a multiressistência (resistência a mais de 3 antibióticos) foi presente em 26% dos isolados. Quanto a presença de genes responsáveis pela produção de betalactamases observou-se uma elevada prevalência nos isolados estudados (68%). Estes dados são convergentes com dados obtidos no estudo realizado no Rio Grande do Sul (OLIVEIRA et al., 2009), porém divergente com achados referentes a países europeus, africanos e asiáticos (BATCHOUN, SWEDAN, SHURMAN, 2009; PITOUT et al., 2009; USEIN et al., 2009). Contudo estes estudos abordaram isolados de infecção de vários sítios anatômicos e não somente de casos de diarreia. Ainda em relação a presença deste marcador de virulência, pode-se notar que os isolados como estes genes obtiveram uma maior amplitude de resistência a antibióticos em relação aos que não apresentaram, tornando a escolha terapêutica difícil. Tanto EAEC como EPEC atípica se mostraram muito 56 susceptíveis a imipenem, cefuroxima, ceftriaxona e medicamentos associados com protetores contra a ação de beta-lactâmicos. Contudo um isolado EPEC atípica se mostrou resistente a ação da tircacilina associada com ácido-clavulânico,o que denota ação de alguns subtipos de beta-lactâmicos, já que os demais foram sensíveis (CARATTOLI, 2009; BUSH, JACOBY, 2010). Pode-se notar, também, que cerca de 58% dos isolados apresentaram mais de quatro fatores de virulência dos onze analisados. Destes sete foram representantes da linhagem EAEC e 4 de EPEC atípica, totalizando 63% e 50% entre os isolados da mesma linhagem, respectivamente. 57 7. CONCLUSÃO Pelo o que foi discutido, verificou-se que os fatores de virulência mais evidenciados nos isolados de E. coli obtidos de amostra de fezes de crianças são: resistência ao soro; a expressão da fímbria curli; produção de biofilme; genes responsáveis pela produção de beta-lactamases. Em relação a resistência a antimicrobianos, verificou-se que cerca de 61% dos isolados que apresentaram genes para beta-lactamases foram resistentes a mais de 3 tipos de antibióticos A forma como os fatores de virulência se apresentaram neste estudo reflete sua ocorrência ocasional, com perfis dispersos nas duas linhagens analisadas, excetuando por dois isolados de EPEC atípica que demonstraram o mesmo perfil de virulência. Deste modo, não houve associação entre as diversas propriedades analisadas, contudo as cepas hemolíticas foram as mais virulentas com cinco propriedades de virulência para cada isolado hemolítico. Pode-se notar, também, que um isolado de EPEC atípica e EAEC, produtores de hemolisina, apresentaram a mesma combinação de fatores de virulência analisados. Em relação a hemolisina, pode-se notar que a melhor atividade se deu na presença de EDDA e cloreto de cálcio. Em contraste esta ação foi praticamente nula no meio que apresentava EDTA. Interessantemente os meio que continham íons de magnésio, níquel, ferro e soro humano foram similares, quanto à hemólise, ao meio puro. Cabe salientar que dos quatro isolados com atividade hemolítica no sobrenadante (exotoxina), três apresentaram atividade hemolítica de contato (endotoxina). 58 8. REFERÊNCIAS BIBLIOGRÁFICAS ALDICK, T., et al. Vesicular stabilization and activity augmentation of enterohaemorrhagic Escherichia coli haemolysin. Mol Microbiol, v.71, n.6, Mar, p.1496-508. 2009. BALDWIN, T. J., et al. Enteroaggregative Escherichia coli strains secrete a heat-labile toxin antigenically related to E. coli hemolysin. Infect Immun, v.60, n.5, May, p.2092-5. 1992. BATCHOUN, R. G., S. F. SWEDAN,A. M. SHURMAN. Extended Spectrum beta-Lactamases among Gram-Negative Bacterial Isolates from Clinical Specimens in Three Major Hospitals in Northern Jordan. Int J Microbiol, v.2009, p.513874. 2009. BAUER, A. W., et al. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathology, v.45, n.4, p.493-496. 1966. BEUTIN, L., et al. Enterohemolysin, a new type of hemolysin produced by some strains of enteropathogenic E. coli (EPEC). Zentralbl Bakteriol, v.267, p.576588. 1988. BHAKDI, S., et al. Escherichia coli hemolysin may damage target cell membranes by generating transmembrane pores. Infect Immun, v.52, n.1, Apr, p.63-9. 1986. BHUIYAN, S. H., H. RAHMAN,K. HAIDER. Study of hemagglutinating property of enteroinvasive Escherichia coli from various geographical locations. JPN J Med Sci Biol, v.193-8, p.193-198. 1995. BLACK, R. E., K. H. BROWN,S. BECKER. Malnutrition is a determining factor in diarrheal duration, but not incidence, among young children in a longitudinal study in rural Bangladesh. Am J Clin Nutr, v.39, n.1, Jan, p.87-94. 1984. BOISEN, N., et al. New adhesin of enteroaggregative Escherichia coli related to the Afa/Dr/AAF family. Infect Immun, v.76, n.7, Jul, p.3281-92. 2008. BRYCE, J., et al. WHO estimates of the causes of death in children. Lancet, v.365, p.1147-1152. 2005. BUERIS, V., et al. Detection of diarrheagenic Escherichia coli from children with and without diarrhea in Salvador, Bahia, Brazil. Mem Inst Oswaldo Cruz, v.102, n.7, Nov, p.839-44. 2007. BUSH, K.,G. A. JACOBY. Updated Functional Classification of β-Lactamases. Antimicrob Agents Chemother, v.54, n.3, p.969-976. 2010. CARATTOLI, A. Resistance Plasmid Families in Enterobacteriaceae. Antimicrob Agents Chemother, v.53, n.6, p.2227–2238. 2009. 59 CHAUDHARY, U.,R. AGGARWAL. Extended Spectrum β-lactamases (ESBL) - An Emerging Threat to Clinical Therapeutcs. Indian J Med Microbiol, v.2, p.75-80. 2004. CLEGG, S.,D. C. OLD. Fimbriae of Escherichia coli K-12 strain AW405 and related bacteria. J Bacteriol, v.137, n.2, p.1008-1012. 1979. COOKSON, A. L., et al. Molecular Subtyping and Genetic Analysis of the Enterohemolysin Gene (ehxA) from Shiga Toxin-Producing Escherichia coli and Atypical Enteropathogenic E. coli. Appl Environ Microbiol, v.73, n.20, Oct, p.6360-6369. 2007. COQUE, T. M., F. BAQUERO,R. CANTON. Increasing prevalence of ESBLproducing Enterobacteriaceae in Europe. Euro Surveill, v.13, n.47, Nov 20. 2008. CZECZULIN, J. R., et al. Phylogenetic analysis of enteroaggregative and diffusely adherent Escherichia coli. Infect Immun, v.67, n.6, Jun, p.2692-9. 1999. DA RE, S.,J. M. GHIGO. A CsgD-independent pathway for cellulose production and biofilm formation in Escherichia coli. J Bacteriol, v.188, n.8, Apr, p.307387. 2006. DENNEHY, P. H. Acute diarrheal disease in children: epidemiology, prevention, and treatment. Infect Dis Clin North Am, v.19, n.3, p.585-602. 2005. DOBEREINER, A., et al. The effects of calcium and other polyvalent cations on channel formation by Escherichia coli alpha-hemolysin in red blood cells and lipid bilayer membranes. Eur J Biochem, v.240, n.2, Sep 1, p.454-60. 1996. DYER, J. G., et al. Curli production and genetic relationships among Escherichia coli from cases of bovine mastitis. J Dairy Sci, v.90, n.1, Jan, p.193-201. 2007. ELIAS, W. P., et al. Enteroaggregative Escherichia coli strains among classical enteropathogenic Escherichia coli O serogroups. J Clin Microbiol, v.40, n.9, Sep, p.3540-1. 2002. FERRIERES, L., et al. The yjbEFGH locus in Escherichia coli K-12 is an operon encoding proteins involved in exopolysaccharide production. Microbiology, v.153, n.Pt 4, Apr, p.1070-80. 2007a. FERRIERES, L., V. HANCOCK,P. KLEMM. Specific selection for virulent urinary tract infectious Escherichia coli strains during catheter-associated biofilm formation. FEMS Immunol Med Microbiol, v.51, n.1, Oct, p.212-9. 2007b. 60 FIGUEIREDO, P. M., C. F. CATANI,T. YANO. Thiol-independent activity of a cholesterol-binding enterohemolysin produced by enteropathogenic Escherichia coli. Braz J Med Biol Res, v.36, n.11, Nov, p.1495-9. 2003. FLORES, J.,P. C. OKHUYSEN. Enteroaggregative Escherichia coli infection. Curr Opin Gastroenterol, v.25, n.1, Jan, p.8-11. 2009. FREEMAN, D. J., F. R. FALKINER,C. T. KEANE. New method for detecting slime production by coagulase negative Staphylococci. J Clin Pathol, v.42, p.872-874. 1989. HANCOCK, V., L. FERRIERES,P. KLEMM. The ferric yersiniabactin uptake receptor FyuA is required for efficient biofilm formation by urinary tract infectious Escherichia coli in human urine. Microbiology, v.154, n.Pt 1, Jan, p.167-75. 2008. HAQUE, M. A., et al. Contact hemolysin production by strains of enteroaggregative Escherichia coli isolated from children with diarrhea. J Clin Microbiol, v.32, n.4, Apr, p.1109-11. 1994. HARRISON, J. J., et al. The chromosomal toxin gene yafQ is a determinant of multidrug tolerance for Escherichia coli growing in a biofilm. Antimicrob Agents Chemother, v.53, n.6, Jun, p.2253-8. 2009. HAWSER, S. P., et al. Emergence of High Levels of Extended-Spectrum-βLactamase-Producing Gram-Negative Bacilli in the Asia-Pacific Region: Data from the Study for Monitoring Antimicrobial Resistance Trends (SMART) Program, 2007. Antimicrob Agents Chemother, v.53, n.8, May, p.3280–3284. 2009. HUNT, S., et al. The formation and structure of Escherichia coli K-12 haemolysin E pores. Microbiology, v.154, n.Pt 2, Feb, p.633-42. 2008. JACOBY, G. A. AmpC β-Lactamases. Clin Microbiol Rev, v.22, n.1, p.161182. 2009. KAPER, J. B., J. P. NATARO,H. L. T. MOBELY. Pathogenic Escherichia coli. Nat Rev Microbiol, v.2, p.123-40. 2004. KOCZURA, R.,A. KAZNOWSKI. The Yersinia high-pathogenicity island and iron-uptake systems in clinical isolates of Escherichia coli. J Med Microbiol, v.52, p.637–642. 2003. KOSEK, M., C. BERN,R. L. GUERRANT. The global burden of diarrhoeal disease, as estimated from studies published between 1992 and 2000. Bull World Health Organ, v.81, p.197-204. 2003. MARUVADA, R., A. M. BLOM,N. V. PRASADARAO. Effects of complement regulators bound to Escherichia coli K1 and Group B Streptococcus on the interaction with host cells. Immunology, v.124, n.2, Jun, p.265-76. 2008. 61 MONSTEIN, H.-J., et al. Multiplex PCR amplification assay for the detection of blaSHV , blaTEM and blaCTX-M genes in Enterobacteriaceae. APMIS, v.115, p.1400–1408. 2007. MOYO, S. J., et al. Identification of diarrheagenic Escherichia coli isolated from infants and children in Dar es Salaam, Tanzania. BMC Infect Dis, v.7, p.92. 2007. MULLER, D., et al. Rapid identification and differentiation of clinical isolates of enteropathogenic Escherichia coli (EPEC), atypical EPEC, and Shiga toxinproducing Escherichia coli by a one-step multiplex PCR method. J Clin Microbiol, v.44, n.7, Jul, p.2626-9. 2006. MUSHTAQ, N., et al. Prevention and cure of systemic Escherichia coli K1 infection by modification of the bacterial phenotype. Antimicrob Agents Chemother, v.48, n.5, May, p.1503-8. 2004. NATARO, J. P., et al. Aggregative adherence fimbriae I of enteroaggregative Escherichia coli mediate adherence to HEp-2 cells and hemagglutination of human erythrocytes. Infect Immun, v.60, p.2297-2304. 1992. NATARO, J. P.,J. B. KAPER. Diarrheagenic Escherichia coli. Clin Microbiol Rev, v.11, n.1, Jan, p.142-201. 1998. NATARO, J. P., T. STEINER,R. L. GUERRANT. Enteroaggregative Escherichia coli. Emerg Infect Dis, v.4, n.2, Apr-Jun, p.251-61. 1998. NAVEEN, R.,E. MATHAI. Some virulence characteristics of uropathogenic Escherichia coli in different patient groups. Indian J Med Res, v.122, n.2, Aug, p.143-7. 2005. NICHOLLS, L., T. H. GRANT,R. M. ROBINS-BROWNE. Identification of a novel locus that is required for in vitro adhesion of a clinical isolate of enterohaemorrhagic Escherichia coli to epithelial cells Mol Microbiol v.35, p.275-288. 2000. OLIVEIRA, C. F., et al. Prevalence of the TEM, SHV and CTX-M families of extended-spectrum beta-lactamases in Escherichia coli and Klebsiella spp at the University Hospital of Santa Maria, State of Rio Grande do Sul]. Rev Soc Bras Med Trop, v.42, n.5, Sep-Oct, p.556-60. 2009. PATON, A. W.,J. C. PATON. Detection and Characterization of Shiga Toxigenic Escherichia coli by Using Multiplex PCR Assays for stx1, stx2, eaeA, Enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J Clin Microbiol, v.36, p.598-602. 1998. PELKONEN, S.,J. A. FINNE. A rapid turbidimetric assay for the study of serum sensitivity of Escherichia coli. FEMS Microbiol Lett, v.42, p.53-57. 1987. 62 PEREZ, F., et al. The Continuing Challenge of ESBLS. Curr Opin Pharmacol, v.7, n.5, Oct, p.459-469. 2008. PITOUT, J. D. D., et al. Molecular Characteristics of Travel-Related ExtendedSpectrum-B-Lactamase-Producing Escherichia coli Isolates from the Calgary Health Region. Antimicrob. Agents Chemother., v.53, n.6, Jun, p.2539–2543. 2009. PRASADARAO, N. V., et al. A novel interaction of outer membrane protein A with C4b binding protein mediates serum-resistance of Escherichia coli K1. J Immunol, v.169, p.6352-6360. 2002. REGUA-MANGIA, A. H., et al. Molecular typing and virulence of enteroaggregative Escherichia coli strains isolated from children with and without diarrhoea in Rio de Janeiro city, Brazil. J Med Microbiol, v.58, n.Pt 4, Apr, p.414-22. 2009. ROBINS-BROWNE, R. M., et al. Atypical enteropathogenic Escherichia coli: a leading cause of community-acquired gastroenteritis in Melbourne, Australia. Emerg Infect Dis, v.10, p.1797-1805. 2004. SANSONETTI, P. J., et al. Multiplication of Shigella flexneri within HeLa cells: lysis of the phagocytic vacuole and plasmid-mediated contact hemolysis. Infect Immun, v.51, p.461-469. 1986. SASAKI, H., et al. Identification and characterization of hemolysin-like proteins similar to RTX toxin in Pasteurella pneumotropica. J Bacteriol, v.191, n.11, Jun, p.3698-705. 2009. SCHINDEL, C., et al. Interaction of Escherichia coli hemolysin with biological membranes. A study using cysteine scanning mutagenesis. Eur J Biochem, v.268, n.3, Feb, p.800-8. 2001. SHARMA, M., S. YADAV,U. CHAUDHARY. Biofilm production in uropathogenic Escherichia coli. Indian J Pathol Microbiol, v.52, n.2, Apr-Jun, p.294. 2009. SHIRATSUCHI, A., et al. Bridging effect of recombinant human mannosebinding lectin in macrophage phagocytosis of Escherichia coli. Immunology, v.124, n.4, Aug, p.575-83. 2008. SKALS, M., et al. Alpha-hemolysin from Escherichia coli uses endogenous amplification through P2X receptor activation to induce hemolysis. Proc Natl Acad Sci U S A, v.106, n.10, Mar 10, p.4030-5. 2009. SLAMA, T. G. Gram-negative antibiotic resistance: there is a price to pay. Critical Care, v.12, n.4, May, p.1-7. 2008. STEPANOVIC, S., et al. Biofilm formation by Salmonella spp. and Listeria monocytogenes on plastic surface. Lett Appl Microbiol, v.38, n.5, p.428-32. 2004. 63 TENNANT, S. M., et al. Characterisation of atypical enteropathogenic E. coli strains of clinical origin. BMC Microbiol, v.9, p.117. 2009. TOMA, C., et al. Multiplex PCR assay for identification of human diarrheagenic Escherichia coli. J Clin Microbiol, v.41, n.6, Jun, p.2669-71. 2003. ______. Distribution of putative adhesins in different seropathotypes of Shiga toxin-producing Escherichia coli. J Clin Microbiol v.42, p.4937-4946. 2004. TOTH, I., et al. Production of cytolethal distending toxins by pathogenic Escherichia coli strains isolated from human and animal sources: establishment of the existence of a new cdt variant (Type IV). J Clin Microbiol, v.41, p.42854291. 2003. TRABULSI, L. R., R. KELLER,T. A. TARDELLI GOMES. Typical and atypical enteropathogenic Escherichia coli. Emerg Infect Dis, v.8, n.5, May, p.508-13. 2002. UHLICH, G. A., P. H. COOKE,E. B. SOLOMON. Analyses of the red-dry-rough phenotype of an Escherichia coli O157:H7 strain and its role in biofilm formation and resistance to antibacterial agents. Appl Environ Microbiol, v.72, n.4, Apr, p.2564-72. 2006. UHLICH, G. A., J. E. KEEN,R. O. ELDER. Variations in the csgD promoter of Escherichia coli O157:H7 associated with increased virulence in mice and increased invasion of HEp-2 cells. Infect Immun, v.70, n.1, Jan, p.395-9. 2002. USEIN, C. R., et al. Escherichia coli pathotypes associated with diarrhea in romanian children younger than 5 years of age. Jpn J Infect Dis, v.62, p.5. 2009. VALEVA, A., et al. Putative identification of an amphipathic alpha-helical sequence in hemolysin of Escherichia coli (HlyA) involved in transmembrane pore formation. Biol Chem, v.389, n.9, Sep, p.1201-7. 2008. ______. Binding of Escherichia coli hemolysin and activation of the target cells is not receptor-dependent. J Biol Chem, v.280, n.44, Nov 4, p.36657-63. 2005. VILA, J., et al. Enteroaggregative Escherichia coli virulence factors in traveler's diarrhea strains. J Infect Dis, v.182, n.6, Dec, p.1780-3. 2000. WOOSTER, D. G., et al. Logarithmic phase Escherichia coli K1 efficiently avoids serum killing by promoting C4bp-mediated C3b and C4b degradation. Immunology, v.117, p.482–493. 2006. WYBORN, N. R., et al. Properties of haemolysin E (HlyE) from a pathogenic Escherichia coli avian isolate and studies of HlyE export. Microbiology, v.150, n.Pt 5, May, p.1495-505. 2004. 64 APÊNDICE A American Journal of Tropical Medicine and Hygiene Instructions for Authors Manuscripts and correspondence can be submitted at http://mc.manuscriptcentral.com/ajtmh. Questions about the submission process can be directed to [email protected] or [email protected]. Authors who are unable to submit via the Manuscript Central website may send an electronic copy of their manuscript by e-mail or on a disk. However, we prefer that authors submit their own manuscripts electronically. Self-submission by the corresponding author allows authors greater control over the submission process. In addition, authors can provide us with helpful information, such as suggested and excluded reviewers, contact information for all authors, and comments to the Editor upon submission. Cover Letter and Signatures All manuscripts should be accompanied by a cover letter with the following information: The title of the paper Significance of the paper to the readers of the Journal A statement that the material has not and will not be submitted for publication elsewhere so long as it is under consideration by the American Journal of Tropical Medicine and Hygiene Written disclosure of any relationships or support which might be perceived as constituting a conflict of interest A statement that the material is original and has not already been published First and last names of all contributing authors (middle names and initials are optional), accompanied by a statement indicating that they have participated in the study and concur with the submission and subsequent revisions submitted by the corresponding author Each contributing author must sign a copy of the cover letter and send a copy of the signed cover letter to the journal office in one of the following ways: By mailing it to The American Journal of Tropical Medicine & Hygiene, Wolstein Research Building, Room 4120, 10900 Euclid Avenue, Cleveland, Ohio 44106-4983 USA. By faxing it to 216-368-6987. By uploading the signed letter as a jpeg or tif file upon submission of the first draft of a new manuscript. PDF files cannot be uploaded to the site but can be sent by email to the editorial office. 65 In addition, the corresponding author must sign and return the copyright form upon submission. This form can be accessed on the journal's submission site. Authorship The journal allows up to 15 authors per manuscript. Other contributors may be mentioned in the acknowledgments section or in a footnote to the author list. Only those persons listed as authors on the manuscript must submit their signature to the journal. Manuscript types Original research papers, clinical case reports, technical reports, comprehensive and authoritative reviews, diagnostic exercises, short reports, and Letters to the Editor written in English will be considered. There is no word limit for original research papers, but all efforts should be made to make the paper as succinct as possible. As with all journals, the editors can recommend that certain parts of the paper be eliminated or incorporated into supplementary information. The journal is now accepting review articles. Review articles should be 750-1000 words in length, with no more than 15 references. There are no author page charges for review articles. Images in clinical tropical medicine The American Journal of Tropical Medicine and Hygiene will publish Images in Clinical Tropical Medicine focused on typical and unusual presentations of tropical diseases--infectious and non- infectious--that occur anywhere in the world, whether in developing countries or in immigrants or returning travelers in industrialized countries. This venue is intended to focus on clinical cases that have visual immediacy and are of clinical interest and importance to our readership. We will consider original, high-quality images for publication in this special feature, for which page charges will be waived. Material must not have been published or be under consideration for publication elsewhere. Images may appear in the print version of the Journal, the electronic version, or both. Images will be published in black and white in the print version of the journal (unless the author wishes to pay color charges) and in color in the on-line version of the journal. A compendium of Images in Tropical Medicine will be put together on the ASTMH website for members. Text should be double-spaced in MS Word format, and include a brief title. Up to three authors may be listed. A case may be submitted as an exemplar of a particular aspect of a tropical disease or as an unknown. Submissions should include name, highest academic degree, address, e-mail address, telephone number, and fax number of each author. Text should be no more than 200 words and will be subject to editing and shortening. There may be up to 2 references. Submissions for this section may be submitted at http://mc.manuscriptcentral.com/ajtmh or may be sent to the managing editor for consideration. File types Prepare your manuscript using a word processing program and save it as a .doc or .rtf file. You may also upload .xls or .ppt supplemental files as part of the manuscript submission process. All of these files will be converted to .pdf format. Image files such as .gif, .jpg, .eps, .png, and .tif may be uploaded. These will be converted to small .jpg files. 66 Please do NOT upload .pdf files, as we may need to make some changes to the paper during copyediting. The journal does not accept Microsoft Word 2007 documents at this time. Please use Word's "Save As" option to save your document as an older (.doc) file type The converted .pdf and .jpg files will be the files evaluated during the review process. All original files that you upload, as well as their associated converted files marked as Not for Review at the end of the manuscript submission process, will be available for access by the journal office if necessary. You may upload other file types such as LaTeX files, QuickTime movies, or other image types, but Manuscript Central will not convert these. The peer review participants will only be able to view these unconverted files if they have the appropriate software on their computers. Short Reports A Short Report is preferred for the submission of important preliminary observations, technique modifications or data that simply do not warrant publication as a full paper. Short reports should be approximately 500-1500 words, but must provide adequate information to allow for the same stringent peer review given other submissions. The number of authors, references, and number and size of figures and tables should be limited to the minimum necessary. A brief abstract is required for indexing, but delineated sections, such as Material and Methods, should not be used. Preliminary data published as a short report will not preclude subsequent publication of more complete results if the work is significantly expanded. Letters to the Editor Letters to the Editor should not contain unpublished data or material which is being submitted for publication and will not be cited in this Journal, nor should they be cited elsewhere. Requested and excluded reviewers The journal's submission site allows authors the opportunity to suggest up to six potential reviewers for their manuscript and up to six reviewers to be excluded from reviewing the manuscript. The Editors strongly suggest that authors use this feature when submitting a manuscript to the journal, as it will serve to expedite the review process. Spacing The text should be in 12 point type, fully double-spaced (1? spacing is not acceptable), leaving a margin of 1 inch on all sides. Also double-space table and figure legends, tabular material and references. Number all pages consecutively, starting with the title page. Illustrations Graphs, drawings and photographs (please include patients' permission to use their photographs or "blinders" to protect identity) should be numbered and cited in the text. Color illustrations are costly and can be reproduced only at the expense of the author. 67 Tables Tables should be on a separate page, serially numbered in Arabic numerals, and cited in the text. Tables should be designed for printing in one-column width, if possible, and should never require more than full-page width. Equations While the journal office accepts manuscript submissions in Microsoft Word 2007, we have determined that there are problems associated with equations created by this program’s equation builder. Authors using Microsoft Word 2007 must use the original equation editor, which still exists in Word 2007, or they may use the full MathType add-in to create equations. To access Equation Editor 3.0 in Word 2007, click the Insert tab from the ribbon, then click the Object button from the text group. Select Object from the drop-down menu. When the Object Dialog box appears, scroll down and select Microsoft Equation 3.0 and click OK. Style Proprietary names of drugs or chemicals may not appear in the title but may be used in conjunction with the generic name where the substance is first mentioned in the abstract, and again where first mentioned in the body of the article. Thereafter, use only the generic name. The basis for decisions on viral nomenclature is Stedman's ICTV Virus Words. Symbols and common abbreviations should be spelled out the first time they appear in the abstract, the text, figures legends, and tables. Such abbreviations should conform to the AMA Style Manual. The inventing of abbreviations is not encouraged. No sentence may begin with an abbreviation. Show superscripts, references and subscripts using numbers directly following any punctuation marks. Indicate italics by using italic type, or use the character palette on the Manuscript Central website. See formatting and style glossary below for more complete information and specific examples of usage. Ethical guidelines Experimental investigation papers must state in the Material and Methods section that 1) informed consent was obtained from all human adult participants and from parents or legal guardians of minors, with the name of the appropriate institutional review board having approved the project, and/or 2) the maintenance and care of experimental animals complies with the National Institutes of Health guidelines for the humane use of laboratory animals, or equivalent country authority or agency. Page charges Page charges for manuscripts submitted by a Corresponding Author who is not a current member of the American Society of Tropical Medicine and Hygiene are $125 per printed page, or portion thereof. Society members are entitled to a discount and will pay $100 per page. The Journal publishes articles on a pre-paid basis and does not accept institutional or governmental purchase orders. Page charges are calculated and paid upon receipt of galley proofs.There are no page charges for Letters to the Editor or Book and CD Reviews. 68 Manuscripts that are clinical in nature may qualify for a partial or full waiver of publication charges. Authors who would like their papers to be considered for a waiver should include this request in their cover letter or in the comments to the Editor upon submission. We do not grant any waivers until a paper is accepted. These funds are limited and are provided by the American Committee on Clinical Tropical Medicine and Travelers' Health (ACCTMTH), the clinical branch of the ASTMH. Journal policy on open access Effective July 1, 2008, the journal is allowing authors the option of making their manuscripts freely available online immediately upon publication for an additional fee. Authors may elect to pay a flat fee of $2,500 instead of the usual page charges. This fee does not include the additional charges for printed color figures, which must be paid regardless of whether authors choose the Open Access option. However, authors who elect to pay the Open Access fee may publish their figures in color online at no additional charge. Authors who choose to pay the usual page charges instead of the Open Access fee must honor the journal's twelve-month embargo policy on current content and not deposit their paper in a public repository without permission from the journal office. This policy applies only to papers published in the July 2008 issue or later. Authors may elect this option on the page charge form when they receive their galley proofs, or they may notify the journal office of their decision. Journal policy on depositing NIH-funded manuscripts in PubMedCentral and other repositories On January 11, 2008, the National Institutes of Health (“NIH”) adopted a revised Public Access Policy for peer-reviewed journal articles reporting research supported in whole or in part by NIH funds. Under the revised policy, the grantee shall ensure that a copy of the author’s final manuscript, including any revisions made during the peer review process, is electronically submitted to the National Library of Medicine’s PubMed Central (“PMC”) archive and that the person submitting the manuscript will designate a time not later than 12 months after publication at which NIH may make the full text of the manuscript publicly accessible in PMC. For more information and to deposit your manuscript in this database, visit http://publicaccess.nih.gov. All articles published in 2010 or later will be deposited in PubMedCentral by the journal office. Open access articles will be made freely available on PMC at the time of publication. All other articles will be deposited in PMC but will not be available until the 12-month embargo period has expired. AJTMH requests that authors of manuscripts published BEFORE 2010 do the following to comply with this policy: 1. Deposit the FINAL published paper in PubMed Central, not your author manuscript or galley proofs. 2. Request that PubMed Central honor the journal's 12-month embargo on free access to current content, unless you have paid the author open access fee, in which case your manuscript may be deposited upon publication. If the author pays the open access fee, the journal office will deposit the final version directly in PubMedCentral and it will be made freely available at the time of 69 publication. These articles will be licensed using the Creative Commons, Attribution, Non-commercial license which permits others to use, reproduce, disseminate, or display the open access version of this article for non-commercial purposes provided that the original authorship is properly and fully attributed. This policy is fully compliant with the requirements of funders such as the Wellcome Trust, Medical Research Council and HHMI. If an author does not pay the open access fee but wants the journal office to deposit their article, the author should inform the journal office of this request at the time of publication. The journal office can deposit the article but will put a twelve-month hold on the release to coincide with the journal's embargo on free access to current content. Please note that this only applies to NIH-funded, Wellcome Trust-funded, or other research funded by an agency that has repository guidelines for its authors. If you are not sure, please check with the agency that funded your research to see if they require a manuscript deposit in their repository. SPECIFIC MANUSCRIPT GUIDELINES FIRST MANUSCRIPT PAGE The running heads are flush left. The title, authors, and authors? affiliations are centered. The abstract is flush left, and immediately follows the authors? affiliations with one space between. Left running head: All capital letters (All Caps); last name of first author plus "and Others" e.g., LRH: BOCKARIE AND OTHERS Right running head: All Caps; this is the running head for your ~50-character short title e.g., RRH: PCR-ELISA FOR THE DETECTION OF W. BANCROFTI The Title is centered, Roman type (no bold, no italics except for Genus and species, which are italicized.) No punctuation at the end. e.g., Application of a Polymerase Chain Reaction-ELISA to Detect Wuchereria Bancrofti in Pools of Wild-Caught Anopheles Punctulatus in a Filariasis Control Area in Papua New Guinea Authors' names are centered. Commas are used throughout except at the end of a line. Do not split a name to the next line. Please be sure to use include the first and last name of each author. Middle names or initials are optional. e.g., 70 Moses J. Bockarie, Peter Fischer, Steven A. Williams, Peter A. Zimmerman, Lysaght Griffin, Michael P. Alpers, and James W. Kazura Authors' locations/affiliations: departments, institutions, city, state, and/or country are spelled out in full, in italics using Title Case without any numbers. A semi-colon separates each address. Do not split a phrase to the next line. There is no punctuation after the last author?s location. Do not use any symbols such as asterisks after authors? names to refer to the specific affiliations of authors. Just list the institutions in the order that the author is listed. If two authors are at the same place, it is listed only once, in the order of the first author mentioned. If the country is the United States of America, it is not included in the address because AJTMH is published in the USA. Other countries are spelled out in full with no abbreviations. e.g., Papua New Guinea Institute of Medical Research, Madang, Papua New Guinea; Clark Science Center, Department of Biological Sciences, Smith College, Northampton, Massachusetts; Molecular and Cellular Biology Program, University of Massachusetts, Amherst, Massachusetts; Division of Geographic Medicine, Case Western Reserve University School of Medicine, University Hospitals of Cleveland, Cleveland, Ohio (Note that the authors' addresses, complete with street and room numbers, postal codes, phone, FAX, and e-mail are found only at the end of the text in the Authors? addresses section of the paper, just above the References.) TEXT Format Please provide the following (in order): 1. 2. 3. 4. 5. 6. A concise abstract (150 words maximum) An introductory paragraph Separate sections for Materials and Methods Results Discussion Separate paragraphs for acknowledgments, listing of financial support, all authors' detailed addresses including telephone and FAX numbers, a shipping address for reprints, if reprints are being ordered 7. A list of the references cited. REFERENCES References should be cited by consecutive numbers in the text. The numbers should appear in superscripts, not in parentheses, and should appear after any closing punctuation. Abbreviate journal names in the style used by the National Library of Medicine. References should be from peer-reviewed publications that are generally available to the readers of the Journal. Abstracts, proceedings, works in progress, theses, dissertations, and manuscripts submitted but not yet accepted for publication are not acceptable to cite as references. If it is necessary to cite information from these sources, they should be cited in the text only, in parentheses as follows: (Jamestown JW and others, unpublished data). 71 Format. All authors must be listed; never use "et al." or the phrase "or others." Authors are indicated by their last names followed by a space and their initial(s) (with no period/full stop). Periods are not used after abbreviated words in journal titles. Authors? names are separated by commas only, and is not used. The year of publication follows the final name, preceded by a comma. Double check all information including the correct abbreviation of the journal cited. Note that the abbreviated journal, the volume number, and the colon that follows are in italics. There is a space after the colon, before the page numbers. The page numbers are written out completely: 472--476 (not 473-76). See pages 28--51 in the American Medical Association (AMA) Manual of Style (9th Edition) for various types of reference sources so that you can incorporate them and then modify the formatting for AJTMH as follows: Authors' names: Never use et al. in the references or text. See the following examples: Examples of articles: Michaels E, Bunyan DJP, Charlesworth JM Jr, Black JM III, 1997. Global mapping: lymphatic filariasis in perspective. Parasitol Today 11: 472--476. Examples of books: Olive EA, 1995. Lymphatic Filariasis Infection and Disease. London: Academic Press, 129-131. Chapter in a book: Gilles HM, 1993. Epidemiology of malaria. Gilles HM, Warrell DA, eds. BruceChwatt's Essential Malariology. Third edition. Boston, MA: Edward Arnold, 124-163. Web reference: Centers for Disease Control and Prevention, 2008. Advisory Committee on Immunization Practices (ACIP) recommendations. Available at: http://www.cdc.gov/vaccines/pubs/ACIP-list.htm. Accessed May 1, 2008. At AJTMH, contrary to AMA Style, the year of publication always follows the comma after the last author?s initial(s). Consult Index Medicus for the correct abbreviation of the journal cited. The journal abbreviation, the volume number, and the colon are all italicized. The colon is followed by a space, then the page numbers. The page numbers are both written in their entirety, separated by an en dash which you represent in your manuscript by two hyphens. FORMATTING AND STYLE GLOSSARY Abbreviations and acronyms. The first time it appears, a word or phrase is spelled out in its entirety preceding the abbreviation or acronym which appears in parentheses. The first instance of the acronym is designated in both the abstract and in the text, the first time it appears and for each figure and table, using the acronym subsequently. Try not to use an abbreviation at the beginning of a sentence or as part of a heading. Plurals of acronyms have no apostrophes. STDs. M & Ms. Commonly used abbreviations: Injections. IP = intraperitioneal, IV = intravenous, IM = intramuscular 72 Commas. Always insert a comma before the "and" at the end of a series of three or more items. Ethical guidelines. Ethical considerations must be addressed in the materials and methods section. 1) Please state that informed consent was obtained from all human adult participants and from the parents or legal guardians of minors. Include the name of the appropriate institutional review board that approved the project. 2) Indicate in the text that the maintenance and care of experimental animals complies with National Institutes of Health guidelines for the humane use of laboratory animals, or those of your country?s equivalent authority or agency. Formatting. Use Times New Roman with the font size of 12 throughout. The entire manuscript, including figure legends and tables, should be double spaced (not 1.5 spaces, not a variation such as "equivalent") with one inch margins all around, flush left with a ragged right margin even though when printed in the journal it will be singlespaced and justified?the printer sets all of that up for printing from the manuscript format. Insert only one space between words and sentences, including after a colon (except for the colon after the Acknowledgments, Financial support, Disclaimers, Authors? addresses, and Reprint request sections at the end of the text, just before the REFERENCES). Headings. A primary heading is used for the main sections and is centered alone in all capital letters, no bold or italics. A secondary heading is indented, bold, sentence case, and ends with a period. The text follows on the same line after one space. A tertiary heading is indented, in sentence case, italicized, and ends with a period. Sentences and paragraphs. Indent the first sentence of each paragraph. Try not to use an abbreviation at the beginning of a sentence. Hyphens and dashes. Dashes. Insert 2 hyphens (--) between numbers or other cases whenever it means "to" as in 4 to 6 years (4--6 years, 1994--1999), The printer will translate -- into an "en dash" [?] which is longer than a hyphen. All you need to do is insert 2 hyphens. The proofreader?s mark for an en dash is - . On the rare occasion that you want to put a long dash between the phrases in a sentence for emphasis, use three hyphens (---) to indicate an "em dash" [?]. There are no spaces before or after the hyphen, the en dash, and the em dash. Do not use a -- for the "to" in ratios or mathematical formulas; they require a virgule or forward slash mark. Hyphens. Insert a hyphen between words that together modify a noun (T-cell group, but group of T cells) or when an adverb and other word modify a noun. half-life antimalarial Italics. Italicize the words and phrases in your text directly, do not underline. There is no need to both italicize and underline. Italicize in vitro, in vivo. 73 Nomenclature. Genus and species. Genus is spelled out completely the first time an organism is mentioned in the abstract, the text, and in every figure and table. If you are discussing several different species within a genus, so that the genus is the same for each species mentioned, spell the genus + species out in full the first time each new species is mentioned, even if it seems redundant. After the first time, use the genus abbreviation with a period. Genus and species are always italicized. Do not italicize "spp." or "sensu stricto" or "sensu lato" that may follow genus and species. Genus is italicized when it appears alone (i.e., Plasmodium infections. Adjectives such as plasmodial are not italicized.). Species, when used as in the text is not italicized (i.e., falciparum malaria). Numbers and symbols. Insert one space between the number and the units of measure, no space between the numeral and the % sign. Add a space before and after the ≥, ≤, and = symbols. Parentheses and brackets. Parentheses enclose brackets. In a sentence, the punctuation comes after the close-parentheses symbol. Quotation Marks. Use quotation marks sparingly, only when absolutely necessary for clarity and to designate a particular, unusual use of a word. When redefining a word, use the quotes only in the first instance in both the text and abstract. Subsequent use does not require quotes, as you have already alerted the reader to make the mental adjustment. References and citations Note: Published abstracts; published or unpublished proceedings, works in progress, theses, and dissertations; and manuscripts submitted but not yet accepted for publication are not acceptable references to cite. If it is necessary to cite information from these sources, cite them in the text only, in parentheses as follows: (Jamestown JW and others, unpublished data). See pp. 28--51 in the AMA Manual of Style [9th Edition] for expressing various sources of reference. Modify the formatting for AJTMH as follows: Authors' names. Never use et al. in the references or text. All authors must be listed in the following format: First author?s last name (no comma) single space, his or her initial(s) without periods (no full stops until after the year), comma, single space, next author(s) in the same format until all have been listed. After the final author?s initial(s), comma, single space, insert the year of publication, period (full stop). Year of publication. At AJTMH, contrary to AMA Style, the year of publication always follows the comma after the last author?s initial(s). Journal abbreviation. Consult Index Medicus for the correct abbreviation of the journal cited. The journal abbreviation, the volume number, and the colon are all italicized. The colon is followed by a space before the page numbers. The page numbers are both written in their entirety, separated by 2 hyphens (en dash). Spacing between sentences. Use one space only. 74 Spelling. Use American spelling except in the references where spelling and punctuation follow the original citation. Chagas disease. No apostrophe as per the current CDC standard usage. Bed net. Possum is the correct word for opossum in Australia. Superscripts and subscripts. Use your software to create a true superscript or subscript. Insert superscripts correctly, after the punctuation with no space in between.2,3,6--8 Here, there are no spaces between the reference number 2, the comma, the 3, or the 6--8 of the superscript. For serial references of 3 or more, insert 2 hyphens between numbers. For example: Other studies reported that opossums usually inspect triatomes both manually and visually before ingesting them.1, 6--8,11 For subscripts follow same procedure, check the Subscript box. Symbols. A minus sign itself should be used, not a hyphen. Time. Time of day. Use AM and PM. Time. sec = second(s), msec = millisecond(s); hr = hour(s); yr = year(s); d = day(s). Plurals of years have no apostrophes. 1940s. 1800s. Units of measure. Abbreviate in the Methods section, but not in the abstract, introduction and results (unless describing a procedure), and discussion. Abbreviations. Weights and measures. g = gram and is always lower case, mg, μg. kilogram = kg. L = liter. Use the word ?liter? for liter when it is mentioned alone in the text. Use a capital L for liter in the instance of g/L and in conjunction with m (milliliter = mL), μ (microliter = μL), and d (deciliter = dL). Note that if designations are followed by numerals or letters, capitalize them: i.e., when particular day(s), week(s), site(s), lane(s), subject(s), group(s) and similar designations are followed by numbers or letters (Day 6; Weeks 1--7. Site 15, Lanes A--D; Subjects A2 and A5, Genotype A). When designating without a following number, use the third day, the fifth week, second subject, etc. 75 APÊNDICE B SUBMISSÃO 76 APÊNDICE C ARTIGO Characterization of virulence factors in enteroaggregative and atypical enteropathogenic Escherichia coli strains isolated from children with diarrhea Thiago Azevedo Feitosa Ferro, Francyelle Costa Moraes, Luciana do Carmo Dias, Claude Porcy, Leandro Amorim Soares, Cristina Andrade Monteiro, Nyla Thyara Melo Lobão, Valério Monteiro Neto, Patrícia de Maria Silva Figueirêdo*. INSTITUTIONAL AFFILIATIONS: Núcleo de Doenças Endêmicas e Parasitárias do Centro Universitário do Maranhão – UNICEUMA, SÃO LUIS-BRAZIL RUNNING TITLE : Virulence factors in enteroaggregative enteropathogenic Escherichia coli strains *Dra. Patricia de Maria Silva Figueiredo Av. Josué Montello 01 – Renascença II 65075-120 São Luís, MA, Brazil E-mail: [email protected] and atypical 77 ABSTRACT Enteroaggregative (EAEC) and atypical enteropathogenic (EPEC) Escherichia coli are the most important bacterial etiologic agents causing diarrhea among children, especially in developing countries. The cumulative impact of virulence factors predisposes to disease. 11 EAEC and 8 EPEC strains identified by Polymerase Chain Reaction (PCR), isolated from stool samples of children from São Luís-MA and Macapá-AP were analyzed genotypically and phenotypically for the prevalence of virulence factors. The most frequently detected factor was resistance to serum (94%), followed by curli fimbriae (78%), biofilm production (73%), and gene coding for extended-spectrum beta-lactamase (ESBL) (68%). EPEC isolates showed at least three of the evaluated properties, while EAEC isolates showed at least two. The prevalence of these virulence factors between the two strains showed no statistical difference. This study showed the heterogeneity of the virulence profile of the isolates of EAEC and atypical EPEC strains and suggests that this diversity may influence in the disease severity. Key words: EAEC, atypical EPEC, virulence factors. 78 INTRODUCTION A survey by the World Health Organization (WHO), from 2002 to 2003, found that 73% of the 10.6 million annual deaths of children under five years old were related to five causes. Diarrheal disease is the second most common (18%), after pneumonia (19%), which evidences the importance of this illness to public health, since it causes deep impacts on the infant morbidity and mortality rates, especially in the less developed regions in the world1. Despite recent studies showing that there was a significant reduction in infant mortality rates due to diarrhea from 4.6 million per year to approximately 2.5 million per year worldwide, such values are still considered high and the morbidity rates remain as high as 30 years ago2. Several pathogens such as bacteria, viruses and intestinal parasites are related to diarrhea in humans. Among them, Escherichia coli is the most important etiologic agent in childhood and represents the biggest public health problem in developing countries 3. Diarrheagenic strains of E. coli (DEC) are classified in 6 subtypes, with differences among themselves and between them and non-pathogenic microorganisms, members of the normal human flora, according to their virulence properties4. Among these properties, we highlight those which enable the bacterium to recognize and colonize the surface of the host’s cells (fimbrial and non-fimbrial adhesins); production of toxins and hemolysins; expression of iron uptake systems (siderophores); and resistance to antibiotics and to the immune system. 79 Currently, the two most important diarrhea agents that affect children under five years old among the isolates of E. coli, both in developed and developing countries, are enteroaggregative (EAEC) and enteropathogenic (EPEC) 5. EPEC causes a histopathological lesion known as “attaching and effacing” (A/ E). Strains of A/ E genotype, which do not possess the plasmid Enteropathogenic E. coli Adherence Factor (EAF), are classified as atypical EPEC 6. Enteroaggregative E. coli (EAEC) are defined as E. coli strains that adhere in vitro to HEp-2 cells in a pattern known as autoaggregative7. Although a large number of virulence factors have been identified in EAEC and EPEC, not even a single factor seems to be present in all the pathogenic strains. Despite its high prevalence, the enteropathogenicity in these two groups is not completely established yet8,9. This happens due to: few systematic studies on the virulence and heterogeneity properties of these characteristics. This study aimed to investigate the virulence factors prevalence, some of which have been previously investigated in EAEC and EPEC, isolated from children under 5 years old in São Luís-MA and Macapá-AP. MATERIALS AND METHODS Pathogen identification: 19 E. coli, among EAEC and EPEC were isolated from stool samples from children under 5 years old in the cities of São Luís-MA and Macapá-AP. These samples were kept in Cary-Blair transport medium and grown in MacConkey agar medium to select E. coli isolates. Colonies with the assumed morphology of E. coli were selected and submitted to biochemical tests. E. coli isolates were stored at -80°C in Brain and Heart Infusion (BHI) with 20% of glycerol for further procedures. 80 Molecular identification of pathogenic categories of Escherichia coli and virulence markers: DNA extraction was obtained from E. coli cultures grown during the night they were resuspended in sterile distilled deionized water and boiled for 5 to 10 minutes. The survey included the detection of genes or DNA conserved regions for analysis of the diarrheagenic E. coli strain type: eae (for EPEC and EHEC), stx 1 and stx 2 (for EHEC), elt and est (for ETEC), ipaH (for EIEC) and aggR (for EAEC)10. The colonies eae+ and stx- were researched for the presence of bfpA gene (which encodes the pilin of the Bundle Forming Pilus fimbriae) to discriminate subgroups of EPEC (typical, bfpA carriers and atypical, lacking this gene). It was also included in this study the investigation of other virulence markers, which encode: extended-spectrum beta-lactamase (ESBL), cytolethal distending toxin (cdt), enterohemolysin (hlyAehec), and the siderophore yersiniabactin (irp), homologue adhesion irgA (iha) and adherence factor of enterohemorrhagic Escherichia coli (EHEC). The primers used are listed in Table 1. Detection of hemolytic activity: to search for the hemolysin on blood agar, the Escherichia coli strains were grown in Brain and Heart Infusion (BHI) at 37°C for 24h in stationary culture. After bacterial growth, strains were grown on the surface an in depth in agar Muller Hinton, with 5% of sheep erythrocytes washed with phosphate buffered saline (PBS) at pH 7.4 11. Identification of type I fimbriae: performed by growth in BHI for 24h at 37°C. Right after, a portion of each culture was centrifuged three times (12000 rpm for 15 minutes), always discarding the supernatant and putting PBS pH 7.4. About 500µl of the isolates were mixed, on glass slides, with 500µl of blood washed three times with PBS, with and 81 without addition of mannose. The samples that produced hemagglutination only in the absence of mannose were considered positive for type I fimbriae 12. Identification of curli fimbriae: the culture was grown at 37°C in Luria Bertani medium (LB), with pH 8, for 24h. Afterwards, the culture was sown on LB plates (without salt) with 0.004% of Congo Red and 0.002% of Bright Blue. The plates were incubated for 24 to 48 hours at room temperature. Red or pink colonies indicate curliproducing bacteria13. Biofilm production: performed by the cultures in BHI, 24h after inoculation at 37°C. Right after, a portion of each culture was diluted to 1:40 in BHI sterile medium. Each sample, already standardized, was added to tissue culture plates with 96 wells deep Ushaped, in triplicate, along with controls, 20µL/well. Once completed, the plates were incubated at 37°C for 24h in microbiological oven. After the incubation, the plates were washed three times with PBS buffer with pH 7.4 and let to dry at room temperature. On the dry plates was added 200µL of crystal violet in each well for 15 minutes at room temperature. Then, each well was washed three times with sterile distilled water and dried at room temperature. The plates were stained with crystal Violet and submitted to spectrophotometry with a 470ηm filter to measure the respective absorbance for each well. Basing on the optical density (D.O.i) produced by the isolates, and taking as basis the negative control (D.O.c), isolates classified in the following categories14: NonProducer: D.O.i < D.O.c; Poor Producer: D.O.c < D.O.i ≤ (2X D.O.c); Moderate Producer: (2X D.O.c) < D.O.i ≤ (4X D.O.c); Strong Producer: (4X D.O.c) < D.O.i. Serum Resistance: the isolates were incubated in BHI at 37°C for 24 hours. 500µl of the culture was incubated in 4.5 ml of sterile BHI for 90 minutes at 37°C. Then, the isolates were centrifuged for 15 minutes, to resuspend in PBS later. 120µl of the 82 resuspended isolates were incubated with 60µl of human serum. The absorbance was analyzed at 0, 30, 60, 90 and 120 minutes. Three types of human serum were used for the test: 1) Inactivated serum at 56°C for 30 minutes; 2) Serum treated with 10mM of EDTA; and 3) normal human serum (NHS). The isolates which had reduced the absorbance in 50% were considered sensitive; in 50 to 90% of the initial absorbance, were considered intermediate resistant; and above 90, as resistant 15. Statistical analysis: it was performed using ANOVA and multiple logistic regression, where p < 0.05 was considered statistically significant. RESULTS The distribution of the virulence factors is shown in Table 2. All examined virulence factors were more prevalent in the EPEC group, except for the presence of bla TEM gene and serum resistance. Besides, all the isolates from this group show at least 3 virulence factors. The most prevalent property among the 11 EAEC isolates was serum resistance (100%), followed by curli fimbriae (63.3%), biofilm production (63.3%) and bla TEM gene (63.3%); while curli fimbriae (87.5%) and serum resistance (87.5%) were more prevalent in the EPEC group. However, there was no association between the presence of any of these factors and the two evaluated groups (p > 0.05). Table 3 shows the combination of several virulence factors, according to the E. coli strain. The number of isolates with 3 or more factors was higher in the EPEC group (100%) than in the EAEC group (82%). However, the most complex combination of factors was found in the second group. 83 Notably, the isolates with hemolytic activity were more homogeneous and had a larger number of associated properties. The frequency of the virulence factors of these isolates was: 100% of the isolates showed biofilm production and serum resistance, 75% curli fimbriae and blaTEM. Interestingly, only 2 isolates (10.5%) had the profile with bla TEM, biofilm production, curli fimbriae, serum resistance and hemolysis; and other 2 with bla CTX-M, biofilm, curli and serum resistance. Serum resistance assays The survival of both enteroaggregative and enteropathogenic E. coli strains was examined: in normal human serum (NHS); under conditions which inactivated the classical and the alternative pathways of the complement system; and in inactivated serum. Over 70% of the isolates survived to two hours of incubation in normal serum and about 21% decreased significantly after 30 minutes of incubation (Figure I) On the other hand, when the isolates were incubated in heat–inactivated or EDTA– treated serum, they did not decrease. The visualized growth was similar between these types of serum (p > 0.05), but different when compared to normal serum (p > 0.05), which evidences the importance of the alternative and the classical pathways, indicating that the intact complement system is essential for the bactericidal activity. It was not verified any association between the serum resistance and any other factors mentioned in this study (p > 0.05). Biofilm production assays In this study, about 73% of the isolates were biofilm producers (Figure II). 60% of the poor producers were EAEC, while 56% of the moderate and strong producers were 84 EPEC. However, there was no difference between the strains (p > 0.05). Among the EPEC isolates, 50% were strong producers and 12.5% were moderate producers. In relation to the difference virulence factors determined by producers versus nonproducers, curli fimbriae was the most prevalent factor in the first group (85%), but there was no association between this or other factors with biofilm (p > 0.05). DISCUSSION Several studies have reported the prevalent heterogeneity of different virulence factors among EAEC and atypical EPEC isolates, due to which the pathogenicity mechanism of the infection in these two strains is not completely understood yet. This study determined the distribution of 16 virulence factors in EAEC and atypical EPEC isolates. There was no association between these strains specific properties. There are few studies evaluating the prevalence of these properties in the isolates we studied, especially in São Luís and Macapá. None of the studied properties was present in all the isolates, however this study identified serum resistance, curli fimbriae and ESBL as the most frequent among the isolates. All the evaluated properties were more prevalent in EPEC than in EAEC. The most present factor in EPEC was curli fimbriae (100%), biofilm production and serum resistance (87.5% each); while in EAEC, the most frequent was serum resistance (100%), biofilm, curli fimbriae and bla TEM (63.3% each). However, these factors were not specific for EAEC and EPEC. The number of isolates carrying 4 or more virulence factors was expressive in all strains (63%). Some authors suggested that only strains presenting at least 2 virulence factors should be considered as potential pathogens16. 85 Compared to other studies performed with EAEC and atypical EPEC isolated from children in developing countries, our data showed significant differences and a few similarities. Recent researches report high variation in the presence of yersiniabactin (22% to 60%), moderate prevalence of cdt (8% to 23%), efal (20%) and iha (20%)8,17,18. Most of them were not found in this study. On the other hand, ESBL was found in most of the isolates: in our study, this factor was detected in 13 (68%). This result is similar to the other studies data, which show a big number of Escherichia coli samples with bla TEM and bla CTX-M genes.19,20,21 One of the most important properties in pathogenic microorganisms is the resistance to bactericidal activity. To survive, microorganisms must avoid serum bactericidal activity to establish infection. The complement system is the first line of defense and the greatest weapon of innate immunity. E. coli has shown strategies to regulate several steps of the complement system cascade, such as ability to reduce or delay C3b deposition through the outer protein of the membrane A.22,23,24 Interestingly, we demonstrated that only one isolate in this research was sensitive to the bactericidal activity, although growth in normal human serum (NHS) has been smaller than in EDTA–treated serum and heat–inactivated serum. This data suggests that the survival pattern of both EAEC and EPEC strains is the same and that the classical and the alternative pathways of the complement system contribute to control the isolates growth. In conclusion, our data has clearly indicated that both EAEC and atypical EPEC present a heterogeneous combination of virulence factors. Thus, it’s not possible to associate any of these properties or combinations with the two groups. ACKNOWLEDGMENTS: Fundo de Amparo a Pesquisa do Estado do Maranhão FAPEMA , 86 REFERENCES 1-Bryce J;Boschi-Pinto C;Shibuya K ;Black RE 2005. WHO estimates of the causes of death in children. Lancet 365: 1147-1152. 2-Kosek M;Bern C ;Guerrant RL 2003. The global burden of diarrhoeal disease, as estimated from studies published between 1992 and 2000. Bull World Health Organ 81: 197-204. 3-Moyo SJ;Maselle SY;Matee MI;Langeland N ;Mylvaganam H 2007. Identification of diarrheagenic Escherichia coli isolated from infants and children in Dar es Salaam, Tanzania. BMC Infect Dis 7: 92. 4-Naveen R ;Mathai E 2005. Some virulence characteristics of uropathogenic Escherichia coli in different patient groups. Indian J Med Res 122: 143-7. 5- BUERIS, V., et al. Detection of diarrheagenic Escherichia coli from children with and without diarrhea in Salvador, Bahia, Brazil. Mem Inst Oswaldo Cruz, v.102, n.7, Nov, p.839-44. 2007. 6-Trabulsi LR;Keller R ;Tardelli Gomes TA 2002. Typical and atypical enteropathogenic Escherichia coli. Emerg Infect Dis 8: 508-13. 7-Flores J ;Okhuysen PC 2009. Enteroaggregative Escherichia coli infection. Curr Opin Gastroenterol 25: 8-11. 8-Mendez-Arancibia E;Vargas M;Soto S;Ruiz J;Kahigwa E;Schellenberg D;Urassa H;Gascon J ;Vila J 2008. Prevalence of different virulence factors and biofilm production in enteroaggregative Escherichia coli isolates causing diarrhea in children in Ifakara (Tanzania). Am J Trop Med Hyg 78: 985-9. 9-Kim JH;Kim JC;Choo YA;Jang HC;Choi YH;Chung JK;Cho SH;Park MS ;Lee BK 2009. Detection of cytolethal distending toxin and other virulence characteristics of enteropathogenic Escherichia coli isolates from diarrheal patients in Republic of Korea. J Microbiol Biotechnol 19: 525-9. 10-Toma C;Lu Y;Higa N;Nakasone N;Chinen I;Baschkier A;Rivas M ;Iwanaga M 2003. Multiplex PCR assay for identification of human diarrheagenic Escherichia coli. J Clin Microbiol 41: 2669-71. 11- Beutin, L., et al. Enterohemolysin, a new type of hemolysin produced by some strains of enteropathogenic E. coli (EPEC). Zentralbl Bakteriol, v.267, p.576-588. 1988. 12-Clegg S ;Old DC 1979. Fimbriae of Escherichia coli K-12 strain AW405 and related bacteria. J Bacteriol 137: 1008-1012. 13-Da Re S ;Ghigo JM 2006. A CsgD-independent pathway for cellulose production and biofilm formation in Escherichia coli. J Bacteriol 188: 3073-87. 87 14 Stepanovic S;Cirkovic I;Ranin L ;Svabic-Vlahovic M 2004. Biofilm formation by Salmonella spp. and Listeria monocytogenes on plastic surface. Lett Appl Microbiol 38: 428-32. 15 Pelkonen S ;Finne JA 1987. A rapid turbidimetric assay for the study of serum sensitivity of Escherichia coli. FEMS Microbiol Lett 42: 53-57. 16 Okeke IN;Lamikanra A;J. C;Dubovsky F;Kaper JB ;Nataro JP 2000. Heterogeneous virulence of enteroaggregative Escherichia coli strains isolated from children in southwest Nigeria. J Infect Dis 181: 252-260. 17-Huang DB;Mohamed JA;Nataro JP;DuPont HL;Jiang ZD ;Okhuysen PC 2007. Virulence characteristics and the molecular epidemiology of enteroaggregative Escherichia coli isolates from travellers to developing countries. J Med Microbiol 56: 1386-92. 18 Tennant SM;Tauschek M;Azzopardi K;Bigham A;Bennett-Wood V;Hartland EL;Qi W;Whittam TS ;Robins-Browne RM 2009. Characterisation of atypical enteropathogenic E. coli strains of clinical origin. BMC Microbiol 9: 117. 19- Coque TM, Baquero F, Canton R. Euro Surveill. 2008 Nov 20;13(47). pii: 19044. Increasing prevalence of ESBL-producing Enterobacteriaceae in Europe. 20 Oliveira CF;Dal Forno NL;Alves IA;Horta JA;Rieger A ;Alves SH 2009. Prevalence of the TEM, SHV and CTX-M families of extended-spectrum beta-lactamases in Escherichia coli and Klebsiella spp at the University Hospital of Santa Maria, State of Rio Grande do Sul]. Rev Soc Bras Med Trop 42: 556-60. 21- Lago A;Fuentefria SR ;Fuentefria DB 2010. ESBL-producing enterobacteria in Passo Fundo, State of Rio Grande do Sul, Brazil. Rev Soc Bras Med Trop 43: 2010. 22- Prasadarao NV;Blom AM;Villoutreix BO ;Linsangan LC 2002. A novel interaction of outer membrane protein A with C4b binding protein mediates serum-resistance of Escherichia coli K1. J Immunol 169: 6352-6360. 23-Wooster DG;Maruvada R;Blom AM ;Prasadarao NV 2006. Logarithmic phase Escherichia coli K1 efficiently avoids serum killing by promoting C4bp-mediated C3b and C4b degradation. Immunology 117: 482–493. 88 24-Maruvada R;Blom AM ;Prasadarao NV 2008. Effects of complement regulators bound to Escherichia coli K1 and Group B Streptococcus on the interaction with host cells. Immunology 124: 265-76. 25-Toth I;Herault F;Beutin L ;Oswald E 2003. Production of cytolethal distending toxins by pathogenic Escherichia coli strains isolated from human and animal sources: establishment of the existence of a new cdt variant (Type IV). J Clin Microbiol 41: 4285-4291. 26- Robins-Browne RM;Bordun A-M;Tauschek M;Bennett-Wood V;Russell J;Oppedisano F;Lister NA;Bettelheim KA;Fairley CK;Sinclair MI ;Hellard ME 2004. Atypical enteropathogenic Escherichia coli: a leading cause of community-acquired gastroenteritis in Melbourne, Australia. Emerg Infect Dis 10: 1797-1805. 27-Toma, C., et al. Multiplex PCR assay for identification of human diarrheagenic Escherichia coli. J Clin Microbiol, v.41, n.6, Jun, p.2669-71. 2003. 28-Czeczulin JR;Whittam TS;Henderson IR;Navarro-Garcia F ;Nataro JP 1999. Phylogenetic analysis of enteroaggregative and diffusely adherent Escherichia coli. Infect Immun 67: 2692-9. 29-Monstein H-J;Östholm-Balkhed Å;Nilsson Mv;Nilsson M;Dornbusch K ;Nilsson Le 2007. Multiplex PCR amplification assay for the detection of blaSHV , blaTEM and blaCTX-M genes in Enterobacteriaceae. APMIS 115: 1400–1408. 30-Nicholls L;Grant TH ;Robins-Browne RM 2000. Identification of a novel locus that is required for in vitro adhesion of a clinical isolate of enterohaemorrhagic Escherichia coli to epithelial cells Mol Microbiol 35: 275-288. 31-Paton AW ;Paton JC 1998. Detection and Characterization of Shiga Toxigenic Escherichia coli by Using Multiplex PCR Assays for stx1, stx2, eaeA, Enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J Clin Microbiol 36: 598-602. 32- Toma C;Martinez EE;Song T;Miliwebsky E;Chinen I;Iyoda S;Iwanaga M ;Rivas M 2004. Distribution of putative adhesins in different seropathotypes of Shiga toxinproducing Escherichia coli. J Clin Microbiol 42: 4937-4946. 89 TABLE I - Primers used to identify different Escherichia coli virulence factors. Gene Virulence Factor Sequence (5' a 3') Amplicon size Reference (bp) aggR Transcription factor GTATACACAAAAGAAGGAAGC 254 ACAGAATCGTCAGCATCAGC cdt Cytolethal distending toxinl GAAARTAAATGGAAYAYAMATGTCCG 10 466 AATCWCCWRSAATCATCCAGTTA bfpA Bundle-forming pili ATTGAATCTGCAATGGTGC 25 461 ATAGCAGTCGATTTAGCAGCC eae Intimin CCCGAATTCGGCACAAGCATAAGC 26 881 CCATACTGATTGCCGCAAT stx Verotoxin GAGCGAAATAATTTATATGTG 27 518 TGATGATGGCAATTCAGTAT irp2 yersinIabactin AAGGATTCGCTGTTACCGGAC 27 264 TCGTCGGGCAGCGTTTCTTCT bla TEM TCGCCGCATCACACTATTCTCAGAATGA 28 445 ACGCTCACCGGCTCCAGATTTAT bla CTX- ATGTGCAGYACCAGTAARGTKATGGC 593 Extended-spectrum β-lactamases 29 M TGGGTRAARTARGTSACCAGAAYCAGCGG bla ATGCGTTATATTCGCCTGTG SHV 747 TGCTTTGTTATTCGGGCAAA efa1 EHEC factor for adherence AAGGTGTTACAGAGATTA 268 TGAGGCGGCAGGATAGTT hlyEHEC Enterohemolysin GCATCATCAAGCGTACGTTCC 30 534 AATGAGCCAAGCTGGTTAAGCT iha IrgA homologue adhesin CAGTTCAGTTTCGCATTCACC GTATGGCTCTGATGCGATG 31 1305 32 90 TABLE IIVirulence factors in EAEC and EPEC isolates Virulence fator EAEC n (%) EPEC n (%) Cumulative n (%) Biofilm 7 (63) 7 (87) 14 (73) Type I fimbriae 3 (27) 0 3 (15) Curli 7 (63) 8 (100) 15 (78) bla 2 (18) 1 (12) 3 (15) bla 7 (63) 3 (37) 10 (52) Irp 0 2 (25) 2 (10) Iha 0 1 (12) 1 (5) 11 (100) 7 (87) 18 (94) 2 (18) 2 (25) 4 (20) CTX-M TEM Serum resistance Hemolysis The others virulence factors were not founded in isolates studied. 91 TABLE III Combinations of putative virulence factors among EAEC and EPEC strains Strain Virulence factors combination Nº virulence Nº (%) of factors EAEC strains bla TEM, Biofilm, curli, R Factor, Hemolysis 5 1 (9%) bla TEM, Biofilm, type I fimbriae, R Factor, 5 1 (9%) 4 1 (9%) Biofilm, curli, type I fimbriae, R Factor 4 1 (9%) bla CTX-M, Biofilm, curli, R Factor 4 1 (9%) bla TEM, Biofilm, type I fimbriae, R Factor 4 1 (9%) bla TEM, Biofilm, curli, R Factor 4 1 (9%) bla CTX-M, Biofilm, R Factor 3 1 (9%) bla TEM, curli, R Factor 3 1 (9%) Biofilm, R Factor 2 1 (9%) bla TEM, Biofilm 2 1 (9%) bla TEM, Biofilm, curli, R Factor, hemolysis 5 1 (12,5%) irp, Biofilm, curli, R Factor, hemolysis 5 1 (12,5%) bla TEM, irp, curli, R Factor 4 1 (12,5%) bla CTX-M, Biofilm, curli, R Factor 4 1 (12,5%) Biofilm, curli, R Factor, iha 4 1 (12,5%) bla TEM, curli, R Factor 3 1 (12,5%) Biofilm, curli, R Factor 3 2 (25%) hemmolysis bla EPEC TEM, Biofilm, curli, R Factor R Factor – serum resistance. LEGENDS OF FIGURES 92 FIGURE I - Survival of EAEC and EPEC strains in adult human sera. E. coli strains grown overnight (postexponential) were subjected to serum bactericidal assays using adult human sera either untreated (A), EDTA-treated serum(B) and heat-inactivated (C). The results are presented as means of three category (sensible, intermediary and sensible) in individual experiments and are expressed as relative survival with the survival of E. coli at 0 min being taken as 100%. FIGURE II- Biofilm formation (BF) of EAEC and EPEC strains. The mean BF index was higher for EPEC than for EAEC strains, but there was not difference among two strains ANOVA (p > 0,05). 93 94 FIGURE II
