prevalência da infecção pelo vírus da hepatite c (hcv)

Propaganda
PREVALÊNCIA DA INFECÇÃO PELO VÍRUS DA HEPATITE C (HCV)
E COMPARAÇÃO DA METODOLOGIA MOLECULAR E
IMUNOLOGICA DO HCV ENTRE MORADORES DE UM PSF DA
CIDADE DE CRUZ ALTA-RS
REIS, Gabriel Moraes1; ABDALLA, Fátima Hudsein1; BORTOLOTTO, Josiane Woutheres2;
IEGGLI, Carine Viana3
Introdução
A hepatite C foi identificada em 1989, desde então tem sido reconhecida por
especialistas como um problema de saúde pública mundial. Atualmente, estima-se que cerca
de 170 milhões de pessoas, 3% da população mundial, estão infectadas com o vírus da
hepatite C (HCV) (WORLD HEALTH ORGANIZATION, 2000; CRAXI et al., 2008).
A identificação e caracterização do genoma do HCV foram acompanhadas pelo
desenvolvimento de métodos diagnósticos imunológicos e moleculares. O diagnóstico
imunológico é baseado na detecção de anticorpos anti-HCV no plasma ou no soro, utilizando
o ensaio imunoabsorvente ligado à enzima (ELISA). Por outro lado, o diagnóstico molecular é
baseado na detecção do RNA viral e é aceito como “padrão ouro” entre os métodos existentes
de identificação do HCV. Além da detecção qualitativa, a metodologia molecular possibilita
ainda a determinação da carga viral e a determinação do genótipo, ferramentas valiosas para o
manejo clínico do paciente (SILVA & NIEL, 2006). Assim, o presente trabalho tem por
objetivo diagnosticar portadores do vírus da hepatite C comparando a metodologia
imunológica e molecular.
Materiais e Métodos
Seleção da amostragem
A amostragem para realização deste trabalho será composta por moradores
cadastrados em PSF da cidade de Cruz Alta. Não haverá critério de exclusão de amostragem
uma vez que este projeto visa indicar a prevalência do HCV no município.
__________________________________________
1
Autor Acadêmico do Curso de Farmácia da Universidade Cruz Alta-UNICRUZ, - [email protected]
Orientadora,Professora M. Sc. da Universidade de Cruz Alta-UNICRUZ, Orientadora - [email protected]com.br
3
Professora Colaborador Professora Dra. da Universidade de Cruz Alta e docente da Disciplina de Estágio orientado I [email protected]
2
Análise do material
Imunologia
O teste imunológico será realizado utilizando o método de imunoensaio enzimático tipo
Sandwich (ELISA de III geração). Este teste detecta anticorpos IgG anti-HCV circulantes, que são
considerados indicativos de infecção pelo vírus da hepatite C.
Extração RNA
Para extração de RNA será utilizado o protocolo e o reagente TRIzol LS (Invitrogen).
Análise molecular HCV
Utilizar 5 μL do produto de extração de RNA para a realização da técnica de Transcrição
Reversa
(RT).
Para
este
procedimento
utiliza-se
primer
poli
T
(TTTTTTTTTTTTTTTTTTTTTTTTV) e enzima MMLV-RT (Invitrogen) e dNTPs (Invitrogen)
para a confecção do cDNA (DNA complementar).
Para amplificação por PCR (Reação de cadeia polimerase) utiliza-se 10 nmol de
oligonucleotídeos iniciadores HCV1 (5’GGAACTACTGTCTTCACGCAGA3’) e HCV2
(5’TCGCAAGCACCCTATCAGGCAG 3’) (KRUG et al., 1996); tampão 10X, 1,5mM de
MgCl2, 200 μM de dNTP, 0,5 U taq DNA polimerase, cDNA produzido na reação descrita acima
e água suficiente para 20 μL (SILVA & NIEL, 2006).
As amostras negativas para HCV deverão ser submetidas a um controle positivo. Os
produtos de PCR serão analisados através de eletroforese em gel de agarose 2% em tampão TAE
1x, contendo 0,5 μg de brometo de etídio e sob luz ultravioleta. O tamanho do produto de
amplificação é de 259 pb, que corresponde a região 5’ não-codificante do HCV.
Tratamento estatístico
Para a análise da distribuição da freqüência será empregado o programa Excel (for
Windows).
Resultados e discussão
O HCV circula no sangue em baixa concentração (GRETCH, 1997). A detecção de
anticorpos é a maneira mais freqüentemente empregada para identificar a infecção. Destas
técnicas o ELISA de terceira geração (ELISA III) é a metodologia mais utilizada, devido a
rapidez, facilidade de automação, alta confiabilidade e custo relativamente baixo (REIS, 1998).
Este teste inclui antígenos recombinantes para captura de anticorpos, porém é sensível para
detecção de seroconversão de 7 a 8 semanas. Portanto, em pacientes com suspeita de infecção por
HCV, a negatividade da pesquisa por anti-HCV com ELISA III nas primeiras 8 semanas não
exclui a doença (BRANDÃO et al, 2001).
A baixa especificidade do ELISA determinou o desenvolvimento de testes diagnósticos
suplementares, como os testes de biologia molecular que detectam a presença do RNA viral,
sendo hoje considerado teste ouro para diagnóstico de hepatite C (LOK & GUNARATNAM,
1997).
Os testes moleculares são baseados na identificação das regiões mais conservadas do
genoma viral, neste caso, localizadas nas extremidades 5’ e 3’, consideradas importantes sítios de
controle da transcrição e tradução (SILVA e NIEL, 2006). A região não traduzida 5’ (denominada
5’UTR) corresponde à porção mais altamente conservada do genoma, e por esta razão tem sido
usada por muitos laboratórios no diagnóstico molecular do HCV e seus aprimoramentos (ZEIN,
2000).
Os resultados para o teste Elisa III obtidos neste estudo estão resumidos na Tabela 1,
sendo que do total de indivíduos estudados, 4,9% apresentaram anti-HCV reagentes, 3% foram
indeterminados e 89% não reagente. Entretanto, três amostras foram descartadas devido à
hemólise. Atualmente, estima-se que cerca de 170 milhões de pessoas, 3% da população mundial,
estão infectadas com o vírus da hepatite C (HCV) (WORLD HEALTH ORGANIZATION, 2000;
CRAXI et al., 2008). No Brasil, estima-se que em torno de 2,5 a 4,9% da população geral
apresenta anticorpos anti-HCV, o que corresponde a aproximadamente 3,9 a 7,6 milhões de
portadores crônicos com risco de desenvolver cirrose, hepatite crônica ou câncer hepático
(FONSECA, 1999; WORLD HEALTH ORGANIZATION, 2000). Este estudo apresentou dados
coerentes com a prevalência no Brasil e mundo.
Também na tabela 1 apresenta os resultados obtidos pelo teste RT-PCR (Transcriptase
reversa seguida de Reação de cadeia Polimerase), dos 103 indivíduos estudados, 7% foram
positivos e 93% foram negativos, não ocorrendo presença de testes indeterminados como no Elisa.
Em relação às amostras indeterminadas no teste ELISA III, 2 foram confirmadas pelo teste
de RT-PCR e uma foi descartada.
Assim, demonstrou que o teste ELISA III tem menor
sensibilidade quando comparado ao diagnóstico molecular.
Conclusão
Neste trabalho a prevalência de portadores do vírus da hepatite C foi de 4,9% da
população estudada que são pessoas carentes com condições precária de saneamento e orientação
apresentou uma incidência semelhante a do Brasil e acima da média mundial é que de 3%.
Embora o teste molecular seja considerado o “padrão-ouro” para o diagnóstico do HCV, possui
um relativamente alto, pois ainda não existem grandes empresas brasileiras que produzam os
reagentes para o teste. Já o teste ELISA III apresenta um custo relativamente baixo, porém uma
baixa sensibilidade para detecção de seroconversão de 7 a 8 semanas.
Conclui- se que o diagnóstico molecular apresenta maior seletividade e sensibilidade
possibilitando, um prognóstico favorável no controle da doença.
Tabela 1 – Determinação de anticorpos IgG anti-HCV pelo método imunológico ELISA III e
pelo método molecular RT-PCR (n=103)
ELISA III
Frequência absoluta
%
Reagente
5
4,85
Descartada (hemólise)
3
2,91
Indeterminado
3
2,91
Não Reagente
92
89,32
Positivo
7
4,85
Negativo
96
2,91
RT-PCR
Referências
BRANDÃO, ABM et al. Diagnóstico da hepatite C na prática médica: revisão da
literatura. Revista Panamericana de Salud Pública 9: 1-14, 2001.
CRAXI A, LAFFI G e ZIGNERO AL. Hepatitis C virus (HCV) infection: A systemic disease.
Molecular Aspects of Medicine 29: 85-95, 2008.7
GRETCH DR. Use and interpretation of HCV diagnosis tests in the clinical setting. Clin
Liver Dis 1: 543-557, 1997.
LOK ASF, GUANARATNAM NT. Diagnosis of hepatitis C. Hepatology 23: 48S-56S,
1997.
WORLD HEALTH ORGANIZATION. Hepatitis C: Global prevalence. Wkly Epidemiol Rec 72
(46): 341-344, 2000.
SILVA CMD, NIEL C. Doenças infecciosas: Diagnóstico molecular. In Rosseti ML, Silva
CMD, Rodrigues JJS. Rio de Janeiro: Guanabara Koogan, P 123 -134, 2006.
SIMMONDS, P et al. A proposed system for the nomenclature of hepatits C vírus genotypes.
Hepatology, 19: 1321-1324, 1994.
ZEIN NN. Clinical significance of hepatitis C virus genotypes. Clinical Microbiology
Review 13: 223 – 235, 2000.
ZEUZEM, S; HULTCRANTZ, R; BOURLIERE, M et al. Peginterferon alfa-2b plus
ribavirin for treatment of chronic hepatitis C in previously untreated patients infected with
HCV genotypes 2 or 3. Journal of Hepatology 40 (6): 993-999, 2004.
ZEIN NN. Clinical significance of hepatitis C virus genotypes. Clinical Microbiology
Review 13: 223 – 235, 2000.
FONSECA ASK, LUNGE VR, IKUTA N et al. New genotype of hepatitis C virus (HCV) in
Brazil. In: XX World Congress of Pathology and Laboratory Medicine. São Paulo.
p.69-74, 1999.
Download