Okazaki proposed the replication is not continuous on both
Propaganda
PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers is amplified The first PCR cycle: The sequence between the two primers will be amplified Four cycles of PCR Copy number of the sequence between the primers increases exponentially SEQUENCIAMENTO DE DNA Profa. Dra. Maria Aparecida Fernandez Depto de Biologia Celular e Genética Universidade Estadual de Maringá Structure of dideoxynucleotide triphosphates Dideoxy DNA sequencing is an in vitro DNA synthesis reaction with a twist DNAP requires a template and a primer The primer is labeled so the DNA fragments synthesized can be detected by autoradiography. The [ddNTP] determines the distribution of chain lengths produced. Alto peso molecular Filme de raio X Auto-radiograma Leitura manual Baixo peso molecular TGGCTCGGCCTCAAGTCGAG GTTATCAGATCTGCAACTCAA Automated DNA Sequencing Reação de seqüênciamento Fragmentos amplificados na reação de seqüênciamento Typical output of an automated sequencer Eletroforese no seqüênciamento Captura do fluorescente e processamento da informação Seqüenciador automático Conjunto de 16 capilares Panorama no momento da corrida Análise preliminar pós corrida ELETROFEROGRAMAS
