Relação entre a plasticidade celular e o fenótipo de resistência a

UNIVERSIDADE FEDERAL DO RIO GRANDE – FURG
INSTITUTO DE CIÊNCIAS BIOLÓGICAS
PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS FISIOLÓGICASFISIOLOGIA ANIMAL COMPARADA
Relação entre a plasticidade celular e o fenótipo de resistência
a múltiplas drogas
Michele Carrett Dias Garcia
Tese defendida no âmbito do Programa
de Pós-Graduação em Ciências Fisiológicas –
Fisiologia Animal Comparada, como parte
dos requisitos para obtenção do título de
DOUTOR em Fisiologia Animal Comparada.
Oientadora: Profª. Drª. Gilma Santos Trindade
Coorientadores: Profª. Drª. Ana Paula de Souza Votto
Prof. Dr. Luis Fernando Marins
Rio Grande, 2015
Agradecimentos
Agradeço a Deus por todas as oportunidades, principalmente a de viver.
Agradeço aos meus pais, Soila e Osmar, pelo apoio e por sempre acreditarem em mim.
Amo muito vocês.
Agradeço às minhas irmãs, Daiane e Daniele, pelo apoio, pela cobrança, por
acreditarem que estudar vale à pena. Não consigo imaginar a minha vida sem vocês.
Agradeço ao meu esposo, pela paciência, pelo amor, pelo mate, por acreditar em mim e
por cuidar dos nossos filhotes caninos Xirú e Luna.
Agradeço aos meus cunhados Rodrigo e Vagner pelo apoio, pelos momentos de
descontração e por cuidarem muito bem das minhas irmãs.
Agradeço aos meus afilhados João Victor, Miguel e Diego, por me ensinarem muito. É
uma forma totalmente diferente de ver a vida. Peço desculpas por não estar presente da
forma que gostaria.
Agradeço também a todos os outros integrantes da minha família, tios, tias, madrinhas
(Ju, Vó Beta e Carlinha por acreditarem em mim e que estudar vale à pena), padrinhos
(Tio Ricardo, Vô Luis e Miri), primos, primas, de todos os graus por ajudarem na minha
formação. A minha formação não foi baseada somente nos conhecimentos desses
últimos anos, e sim desde a base, nas brincadeiras, nas descobertas, nas observações e
por isso que mesmo não estando presentes, agradeço por fazerem parte da minha vida.
Um agradecimento em especial a família do Tio Milton, que sempre me acolheu nesses
anos de FURG como um coração de mãe, onde sempre cabe mais um.
Agradeço ao meu sogro João Paulo, a sogrinha Evani, ao cunhado Mateus e à minha
filha de coração Ana Luiza, família que conheci através do Tiago e que faço parte, pelo
apoio e carinho.
Agradeço a todos os meus amigos, os muito próximos, os próximos, os distantes e os
muito distantes. Como já dizia Milton Nascimento, é para guardar no lado esquerdo do
peito.
No ambiente acadêmico, agardeço a todas as pessoas que fizeram parte do meu convívio
desde a época da graduação. Durante todo o período, desde a graduação até ingressar na
pós graduação, eu sempre tive uma vontade enorme de fazer parte de um laboratório
2
onde as pessoas pareciam felizes e orgulhosas com o que faziam: cultivavam células!
Uau!!! Era tudo o que eu queria! No finalzinho da graduação, o Laboratório de Cultura
Celular estava recém instalado e no mestrado eu também comecei a fazer parte dele. Eu
e as outras pessoas não parecíamos e, sim, éramos muito felizes e orgulhosas com o que
fazíamos. Um ambiente muito sério e agradável. Ao mesmo tempo em que repetíamos
várias vezes os experimentos para ter certeza dos nossos dados e cuidávamos com tanto
zelo e carinho das nossas células, repetíamos o cultivo da amizade, regávamos a alegria
e cantávamos lindas canções que conduziam o nosso ambiente com mais leveza. Toda
vez que caminhava pelo corredor que direciona até o laboratório, eu me sentia feliz e
realizada com a escolha que fiz. Que época maravilhosa essa que vivi entre o mestrado e
o doutorado e por isso agradeço aos responsáveis pelo Laboratório de Cultura Celular,
por me deixarem fazer parte dessa história. Um membro importante desse laboratório e
que esteve presente por todo esse período foi o Técnico Márcio, uma pessoa
maravilhosa, muito querida e que acompanhou todas as angústias e êxitos dos nossos
trabalhos. Não sei se saudade é o termo ideal para descrever a falta que me fará viver
tudo isso.
Agradeço a uma pessoa muito especial que apareceu na minha vida e deixou a sua
marca registrada. A Leda Karine, minha estagiária, mas às vezes eu que era estagiária
dela. Uma pessoa única (dizia que era uma lástima terem colocado a forma fora), super
competente, inteligente, atenta, comprometida e transparente.
Agradeço ao Juliano por acreditar no nosso trabalho e pela análise da morfologia
celular.
Agradeço à Dani Volcan, pela ajuda na biologia molecular desde o mestrado. Sempre
prestativa, super paciente, muito querida e inteligente.
Agradeço as queridonas de grande coração, Dazinha, Bia, Renatinha e Aline, pelo
companheirismo, pela delicadeza, pelo olhar carinhoso e atento, pelos risos, choros,
enfim, por todos os momentos de conversa, de repiques e ajuda. Vocês são demais!
Agradeço a todas as dicas, conversas, descontração dos integrantes dos laboratórios da
cultura e da biomol, tanto os graduandos, como os mestrandos, quanto os doutorandos e
os pós-docs.
3
Agradeço à Maria, o Black, as meninas da portaria, pelo bom dia, pelo café, pelo bom
humor e sempre muito dispostos a ajudar.
Agradeço à minha orientadora Profª. Gilma Trindade e aos meus coorientadores Profª.
Ana Paula Votto e Profº. Luis Fernando Marins, pela oportunidade e pela confiança.
Um agradecimento em especial a minha amiga Gilma. Muito obrigada meu Deus por
essa pessoa tão especial, incrível e principalmente humana fazer parte da minha vida.
Muitas pessoas são fãs de ídolos que talvez nunca saibam da sua existência. Mas eu sou
fã número um dessa pessoa maravilhosa e que não existem palavras suficientes para
descrever todo o meu carinho e agradecimento.
Agardeço a minha amiga Ana Paula, pelos conselhos, pelo empréstimo das orelhas, por
ser teimosa (como ela mesma diz) e por ter um coração de ouro. Graças a sua teimosia
em acreditar nas suas percepções de que estávamos no caminho certo (que estavam
certas) nunca me deixou desistir ou pensar que estava dando tudo errado. Na verdade a
novela mexicana (apelido dado ao meu doutorado) marcada por anseios, pelo atraso de
reagentes e por espera de pessoal chegou ao fim de uma forma bem melhor do que eu
estava imaginando. Essa minha grande amiga é tudo de bom.
Agradeço à professora Vivian Rumjanek pela acolhida, pelo carinho, pela atenção, pela
permissão de realizar atividades no laboratório de Imunologia Tumoral.
Agradeço também ao Raphael Vidal, pelo auxílio na parte do silenciamento gênico, pela
paciência, pela disposição, por responder a todas as dezenas de e-mails cheios de
discussões, dúvidas e questionamentos.
Agradeço a todos os integrantes do grupo religioso que participo pelo apoio, pelas
orações e pelas energias positivas que emanaram principalmente no finalzinho do
doutorado.
Agradeço à diretora Patrícia e à coordenadora Mabel, por entenderem as minhas
atividades, o apoio e a ótima acolhida que tive quando cheguei na E.M.E.F. Jeremias
Fróes.
Um agradecimento a todos os professores do Programa de Pós Graduação em Ciências
Fisiológicas – Fisiologia Animal Comparada por todas as aulas e aprendizado.
E para finalizar, agradeço novamente a Deus. Quantas pessoas tive o prazer de
conhecer, de conviver, de aprender com elas. Certamente, nada acontece por acaso.
4
Sumário
Agradecimentos ............................................................................................................................. 2
Abreviaturas .................................................................................................................................. 7
Resumo Geral ................................................................................................................................ 8
Introdução ................................................................................................................................... 10
Objetivos ..................................................................................................................................... 19
Artigo 1........................................................................................................................................ 20
Abstract ................................................................................................................................... 22
Introduction ............................................................................................................................. 23
Results ..................................................................................................................................... 25
Treatment with high PMA concentrations results in cytotoxicity in MDR and non-MDR cell
lines ..................................................................................................................................... 25
Treatment with PMA induced megakaryocyte differentiation in the cell line K562 but not in
Lucena. ................................................................................................................................ 26
PMA serves as a substrate for the efflux pump in the Lucena cell line ............................... 26
Gene expression of Oct-4, Sox-2, Nanog, Alox-5 and MDR1 in cells treated with PMA ... 26
Alox-5 and Mdr1 gene expression is inverted in K562, Lucena and FEPS cells ................ 27
Discussion ............................................................................................................................... 27
Material and Methods ............................................................................................................. 31
Cell lines and culture conditions ......................................................................................... 31
Treatment of cells with PMA ............................................................................................... 31
Cell viability assay .............................................................................................................. 31
Cytology .............................................................................................................................. 32
Rhodamine 123 extrusion .................................................................................................... 32
Gene expression .................................................................................................................. 33
Statistical analysis ............................................................................................................... 33
Acknowledgements ................................................................................................................. 34
Competing interests ................................................................................................................. 34
Author contributions ............................................................................................................... 34
Funding ................................................................................................................................... 34
References ............................................................................................................................... 35
Table 1..................................................................................................................................... 40
Figures ..................................................................................................................................... 41
Artigo 2........................................................................................................................................ 45
5
Abstract ................................................................................................................................... 47
Introduction ............................................................................................................................. 48
Results ..................................................................................................................................... 50
Basal expression of Oct4, Sox -2 and Nanog gene differs among MDR and non- MDR cell
lines ..................................................................................................................................... 50
Basal expression of Oct4 protein differs from the constitutive gene expression ................. 50
Silenced Lucena cells in Oct4-pg1 pseudogene decreased the expression of Mdr1 gene. .. 50
The Oct4-pg1 pseudogene silencing reduced the Oct4 protein amount.............................. 50
Intracellular marking of Oct4 protein ................................................................................. 50
Pseudogene Oct4-pg1 can influence the ABCB1 protein expression in Lucena cell line ... 51
Silencing of Oct4 - pg1 pseudogene did not alter the sensitivity of Lucena cells to
vincristine ............................................................................................................................ 51
Discussion ............................................................................................................................... 51
Material and methods .............................................................................................................. 54
Cell lines and culture conditions ......................................................................................... 54
Plasmid ................................................................................................................................ 54
POU5F1B silencing ............................................................................................................ 54
Analysis of protein expression by flow cytometry ............................................................... 55
Sensitivity cell line silenced the VCR .................................................................................. 55
Cell viability assay .............................................................................................................. 55
Immunocytochemistry assay ................................................................................................ 56
Gene expression .................................................................................................................. 56
Statistical analysis ............................................................................................................... 57
Competing interests ................................................................................................................. 57
Author contributions ............................................................................................................... 57
Funding ................................................................................................................................... 57
References ............................................................................................................................... 58
Table 1..................................................................................................................................... 62
Figures ..................................................................................................................................... 63
Discussão Geral .......................................................................................................................... 70
Bibliografia geral ........................................................................................................................ 77
6
Abreviaturas
5-LO- Araquidonato 5-lipoxigenase
ABC- ATP binding cassete
ABCB1- ou MDR1, codifica a Glicoproteína-P
ABCC1- ou MRP1, codifica a glicoproteína MRP1
ABCG2- codifica a Glicoproteína ABCG2 ou BCRP ou MXR
CT- Célula-tronco
CTA- Célula-tronco adulta
CTE- Célula-tronco Embrionária
CTH- Célula-tronco Hematopoiética
CTL- Célula-tronco Leucêmica
CTT- Célula-tronco Tumoral
gp-P- Glicoproteína P
K562- Linhagem celular não resistente a múltiplas drogas (MDR)
K562-Lucena- Linhagem celular MDR
LMA- Leucemia Mielóide Aguda
LMC- Leucemia Mielóide Crônica
MDR- Resistência à Múltiplas Drogas
Oct-4 – Fator de Transcrição - marcador de CTT, CTE e células germinativas
Sox-2- Fator de Transcrição - marcador de CTT, CTE e células germinativas
Nanog- Fator de Transcrição - marcador de CTT, CTE e células germinativas
Ph1 – Cromossomo Philadelphia
7
Resumo Geral
O câncer é uma doença que afeta um grande número de pessoas no mundo. Um
dos maiores problemas encontrados é a recidiva. Nesse caso, algumas células do tumor
se tornam resistentes aos quimioterápicos e sua proliferação acaba desenvolvendo
novamente a doença. Ultimamente tem sido atribuído os piores prognósticos do câncer
quanto maior for o envolvimento de células tronco tumorais (CTTs) no processo de
Resistência a Multiplas Drogas (MDR). Dentre os diversos tipos de câncer, as
leucemias tem recebido grande atenção. A Leucemia Mieloide Crônica (LMC), alvo de
estudo desse trabalho, acomete mais de 4.000 pessoas por ano. Para os estudos do
presente trabalho, foi utilizada uma linhagem não-MDR eritroleucemica, LMC,
chamada K562 e linhagens MDR, selecionadas a partir dessa pelo seu fenótipo
resistente e que receberam o nome de Lucena e FEPS. Estudos anteriores demonstraram
a presença dos marcadores de células-tronco hematopoiéticas (CTH) CD34+CD38- nas
linhagens K562 e Lucena. Essas células possuem a propriedade de diferenciação, sendo
percursoras de todos os tipos celulares sanguíneos produzidos na medula óssea. Uma
das propostas de autores, como alternativa no tratamento do câncer, é induzir a
diferenciação celular. No presente trabalho, induzimos a diferenciação utilizando
Phorbol-12-miristato-13acetato (PMA) nas linhagens K562 e Lucena e avaliamos a
resposta dessas células a essa indução de diferenciação. O PMA é conhecido por induzir
diferenciação para megacariócitos na linhagem K562. O presente trabalho corroborou
com a capacidade de diferenciação dessas células; porém, a diferenciação para este tipo
celular não foi observada para a linhagem Lucena, embora a presença de megacariócitos
seja constitutivamente maior no pool celular dessa linhagem MDR quando comparado
ao pool da linhagem K562. O PMA na linhagem Lucena não induz diferenciação para
megacariócitos. Quanto à expressão gênica, alguns autores tem relacionado a
diferenciação de algumas linhagens à baixa expressão do gene Alox-5. Neste trabalho, a
expressão desse gene foi reduzida após o tratamento com PMA, tanto na linhagem
K562 quanto na Lucena. Também os genes relacionados com a característica tronco,
Oct4, Sox-2 e Nanog, foram avaliados, e foi possível observar que o tratamento reduziu
apenas a expressão do gene Nanog na linhagem K562. Já o gene relacionado com o
fenótipo MDR, Mdr1, teve um aumento na expressão na linhagem K562. De acordo
com alguns trabalhos, o fator de transcrição Oct4 pode estar relacionado com o fenótipo
MDR. Na linhagem Lucena, a redução na expressão do gene Alox-5 sugere que a
8
linhagem sofreu algum processo de diferenciação, porém os genes Oct4 e Mdr1 não
foram alterados. De acordo com alguns trabalhos, o gene Oct4 possui 6 pseudogenes e
embora alguns autores tenham demonstrado que pseudogenes traduzem proteínas não
funcionais, outros autores afirmam o contrário. Pseudogenes tem sido encontrados em
cânceres sendo que o pseudogene Oct4-pg1 tem sido apontado como capaz de traduzir
uma proteína funcional. O silenciamento desse pseudogene na linhagem Lucena não
alterou a expressão gênica dos fatores de transcrição Oct4, Sox-2 e Nanog, mas reduziu
a expressão de Mdr1. A nível proteico, o silenciamento do pseudogene Oct4-pg1
reduziu a expressão de Oct4 e da gp-P na linhagem silenciada. Por fim, foi avaliada a
expressão basal dos fatores de transcrição Oct4, Sox-2 e Nanog, bem como dos genes
Mdr1 e Alox-5 nas linhagens K562, Lucena e na linhagem FEPS, também MDR. A
expressão do gene Mdr1 foi menor na linhagem sensível, intermediária na linhagem
Lucena e maior na linhagem FEPS. Em contrapartida, a expressão do gene Alox-5
mostrou um perfil invertido nas linhagens, com maior expressão em K562 (sensível) e
menor em FEPS (MDR). Os fatores de transcrição Oct4 e Sox-2 são mais expressos nas
linhagens MDR quando comparados com a linhagem não MDR, e Nanog é mais
expresso em K562. Como já relatado, o PMA induziu diferenciação para megacariócitos
na linhagem K562 e, considerando a redução na expressão do gene Alox-5, parece que
esse tratamento também induziu algum processo de diferenciação nas linhagens Lucena.
Os resultados deste estudo também mostraram que o gene Alox-5 tem uma relação
invertida com a expressão do gene Mdr1. Já o pseudogene Oct4-pg1 parece regular a
expressão da bomba de efluxo gp-P diretamente ou indiretamente via Oct4.
9
Introdução
Câncer e Leucemia
Nos últimos tempos as pesquisas têm revelado uma grande diversidade de
doenças conhecidas como câncer (Li & Neaves, 2006). Quando uma célula passa a se
reproduzir desobedecendo aos mecanismos normais de controle do ciclo celular e
começa a invadir e colonizar outros tecidos, temos o que denominamos de câncer
(Alberts et al., 2010).
Alguns estudos têm demonstrado a formação do câncer como produto da divisão
celular e diferenciação anormais (Lo et al., 2007; Miyata, 2007). Com algumas
exceções, a identidade das células tumorais no câncer fica incerta, mas observações
apontam para o envolvimento de células tronco somáticas no processo oncogênico
(Lengner et al., 2008).
Dentre os diversos tipos de câncer existentes, iremos destacar uma doença
maligna e progressiva do órgão formador do sangue, caracterizada por proliferação e
desenvolvimento de leucócitos alterados e seus precursores no sangue e medula óssea.
Esse tipo de câncer é chamado de leucemia.
As leucemias são classificadas de acordo com o tipo de célula sanguínea afetada
(Leucemia mieloide ou Leucemia linfocítica) e de acordo com as características da
doença (Leucemia aguda ou Leucemia crônica) (Pokharel, 2012).
A leucemia mieloide crônica (LMC) é uma forma de leucemia na qual a medula
óssea produz muitas células sanguíneas, a partir da transformação malabigna das células
tronco hematopoiéticas em células tronco leucêmicas, e caracterizada pela presença do
cromossomo Philadelphia (Ph1) (Seke Etet et al., 2012; Rowley, 1973). Raramente
ocorre em crianças e é responsável por aproximadamente 4.400 novos casos de
leucemia por ano.
O cromossomo Philadelphia (Ph1) é uma translocação cromossômica
envolvendo os braços 9 e 22 t(9,22)(q34;q11). Parte do proto-oncogene ABL é removido
do cromossomo 9 e inserido ao gene bcr no cromossomo 22. De forma similar, parte do
cromossomo 22 é removido e realocado no cromossomo 9. Essa translocação leva a
criação de um cromossomo 22 mais curto que codifica uma oncoproteína p210 com
uma atividade tirosina quinase aumentada que, consequentemente, leva a uma
aumentada estimulação da divisão celular, comparada com uma célula com a proteína
10
ABL normal (Rowley (1973); Pokharel, 2012). Esse cromossomo é encontrado em 95%
das LMC assim como em algumas leucemias linfoblásticas agudas.
Linhagens celulares são muito utilizadas para estudar os mais diversos tipos de
câncer. Um modelo bastante utilizado é a linhagem celular K562, derivada de células
leucêmicas de uma mulher que sofria de LMC. Esta linhagem possui o cromossomo Ph1
e apresentam mieloblastos como tipo celular (Lozzio & Lozzio, 1975).
Holyoake e colaboradores (1999) demonstraram em amostras de pacientes com
LMC, a presença de células tronco quiescentes e primitivas que possuiam o
cromossomo Ph1 e a expressão de altos níveis do marcador CD34+ e ausência de CD38,
CD45RA ou CD71, além disso, essas células podem sair espontaneamente da fase G0 e
entrar em um estado proliferativo.
Resistência a múltiplas drogas (MDR)
O fenótipo MDR, em células tumorais, é um fenômeno pelo qual tumores que
inicialmente respondiam a determinados quimioterápicos, passam a adquirir resistência
não apenas às drogas utilizadas no tratamento, mas também a um número de outras
drogas que não apresentam uma estrutura comum as primeiras, nem mesmo possuem
um mesmo alvo intracelular (Gottesman & Pastan, 1993). A primeira descrição do
fenômeno MDR é datada do início da década de setenta quando foi demonstrado que
linhagens leucêmicas de células de pulmão de hamster chinês, expostas a concentrações
crescentes de actinomicina D, tornaram-se resistentes a esta droga e também adquiriram
resistência a drogas química e farmacologicamente não relacionadas, como
daunorrubicina e vinblastina, às quais as células não haviam sido previamente expostas
(Biedler & Riehm, 1970). Por sua vez, Dano (1973) observou que esta resistência era
dependente de adenosina trifosfato (ATP), o que indicava um mecanismo ativo para as
células MDR.
Membros da família de transportadores ATP binding cassete (ABC) transportam
vários substratos acoplados com a hidrólise do ATP. A superfamília de transportadores
ABC consiste de 49 subtipos, alguns dos quais funcionam como bombas de efluxo de
drogas (Abcb1, subfamília Abcc e Abcg2) ou transportadores de esteróis (Abca1,
Abca7, Abcg1, Abcg5 e Abcg8) (Ohtsuki et al., 2007).
Existem vários fatores que podem levar ao fenótipo MDR, porém a
superexpressão da gp-P é o mecanismo melhor estudado. Esta proteína é uma
11
glicoproteína de cerca de 170 KDa, da (família ABC), expressa na membrana celular,
responsável por um mecanismo de efluxo, dependente de energia, capaz de bombear
agentes quimioterápicos para fora da célula (Uchiumi et al., 1993). As drogas para as
quais as células que apresentam gp-P são resistentes, possuem estruturas e mecanismos
de ação bastante diversificados, mas em geral são alcalóides originados de plantas ou
fungos, anfipáticos, preferencialmente solúveis em lipídeos (Gottesman & Pastan,
1993).
Linhagens celulares resistentes a múltiplas drogas também são muito utilizadas
nos estudos in vitro, visto que a recidiva ainda é um dos maiores obstáculos enfrentados
no tratamento oncológico (Xin et al., 2013). Para induzir linhagens eritroleucêmicas
resistentes, alguns pesquisadores tem estabelecido modelos in vitro que permitem um
estudo experimental de células resistentes a múltiplas drogas (MDR). Rumjanek et al.
(1994; 2001), utilizando vincristina em células K562, selecionou células resistentes a
esta droga. A essa linhagem MDR foi dado o nome K562-Lucena 1 (Lucena) para
distinguir de sua linhagem parental K562 (Maia et al., 1996 a, b, Marques-Silva, 1996,
Orind et al., 1997). Continuando o estudo, Daflon-Yunes e colaboradores (2013), agora
utilizando daunorrubicina em células K562, também selecionaram células resistentes,
nomeando-as como FEPS.
Uma linhagem celular, com fenótipo MDR, apresenta características que a
define como tal: resistência a drogas não relacionadas (Kartner & Ling, 1989;
Tiirikainen & Krusius, 1991), expressão da Glicoproteína P (gp-P) na superfície da
membrana (Gottesman & Pastan, 1993), extrusão do corante rodamina (Neyfakh, 1988)
e reversão da resistência pelos agentes reversores trifluoperazina, verapamil e
ciclosporina A (Ford & Hait, 1990; Sikic, 1993).
O gene Abcb1 (Mdr1), um dos responsáveis pelo fenótipo MDR, é o gene que
codifica a gp-P (Sonneveld & Wiemer, 1997). Além das células neoplásicas, uma
variedade de tecidos humanos não tumorais expressa diferentes níveis desta
glicoproteína (Schinkel, 1997).
Embora a gp-P seja a proteína melhor estudada nos processos de resistência a
múltiplas drogas (Scharenberg et al., 2002), existem outras proteínas associadas ao
fenótipo MDR. Entre estas se destaca a glicoproteína Abcc1 (Mrp1), a qual apresenta
características sequenciais e estruturais também pertinentes à superfamília ABC de
proteínas de transporte (Bradley & Ling, 1994). Zaman et al. (1994) sugeriram que, a
12
exemplo da gp-P, a Abcc1 age como uma bomba de efluxo de droga, porém com
algumas características singulares. Estudos de transporte in vitro indicam que a Abcc1
humana é capaz de transportar substratos conjugados ao tripeptídeo glutationa (GSH)
através da catálise da proteína glutationa-S-transferase (GST) (Muller et al., 1994). Esta
proteína também é encontrada em vários tecidos normais (Flens et al., 1996).
Em razão da identificação crescente de novas proteínas transportadoras, a
superfamília ABC de transportadores ativos foi ampliada com estudos envolvendo a
proteína Abcg2. Esta é uma proteína igualmente associada ao fenótipo MDR
(Scharenberg et al., 2002). Estes autores demonstraram, através de experimentos de
transfecção, que a expressão de Abcg2 é necessária e suficiente para gerar o fenótipo
MDR em células renais de embrião humano.
Os transportadores de drogas da família ABC tem mostrado proteger células
tronco tumorais de agentes quimioterapêuticos. Os genes Abcb1, Abcg2 e Abcc1 são os
principais genes de resistência a múltiplas drogas, identificados em células tumorais
(Kim et al., 2002; Scharemberg et al., 2002). Uma propriedade particular das células
tronco (CT) é a expressão de altos níveis de transportadores ABC específicos (Dean et
al., 2005).
Célula-tronco
Existem três tipos de célula-tronco: célula-tronco embrionária (CTE), derivadas
das cinco ou seis primeiras divisões do zigoto e precursora de todas as células do
organismo adulto; célula-tronco germinativa (CTG), aquelas que produzem oócitos e
espermatozoides, responsáveis pela reprodução e célula-tronco adultas (CTA), somática
ou progenitora, são consideradas mais limitadas no seu potencial e que produzem
células que se diferenciam em células funcionais maduras responsáveis pela renovação
do tecido normal (Sell, 2004).
As CTs tem duas propriedades únicas que as tornam prováveis precursoras no
desenvolvimento do câncer. Primeiro, muitas vezes elas são as únicas células que tem a
capacidade de se replicar em um determinado tecido. Segundo, através de um processo
chamado de auto-renovação, as CT geram novas CT com capacidades de diferenciação
e de proliferação semelhantes às suas células parentais (Clarke, 2004). O fato de
possuírem essas características e uma vida longa pode levar à acumulação de mais
mutações ao longo das divissões. Além disso, o fato de também existir CT fora do
13
sistema hematopoiético, levanta a possibilidade de que células tronco cancerígenas
podem surgir de outros tecidos e iniciar outros tipos de câncer (Beachy et al., 2004).
As células-tronco específicas de um tecido eram consideradas como capazes de
se diferenciar somente em células do tecido de origem, entretanto, estudos recentes
mostraram que estas células podem se diferenciar em outras linhagens, quebrando
paradigmas e sendo definido como plasticidade celular (Jiang et al., 2002; Herzog et al.,
2003).
As células-tronco tumorais (CTTs) possuem muitas propriedades semelhantes às
das células tronco normais, entre elas: a vida longa tais com relativa quiescência,
resistência a drogas e toxinas através da expressão de diversos transportadores ATPbinding cassete (ABC), capacidade de reparo de DNA ativa e resistência a apoptose
(Dean et al., 2005).
Há bastante tempo a biologia do câncer, desde o seu aparecimento até o
crescimento, tem sido relacionada com a presença de CTT que mesmo constituindo uma
pequena população dentro do tumor, é crítica para sua propagação (Beachy et al., 2004).
Alguns grupos de células, chamados células iniciadoras de tumores, tem sido
identificados no câncer e apresentam a mesma capacidade de auto-renovação, o
potencial de se transformar em qualquer célula na população do tumor em geral e a
capacidade proliferativa para impulsionar a expansão continuada da população de
células malignas. Essas propriedades são intimamente paralelas às que definem CT
normais. Células malignas com estas propriedades funcionais foram chamadas de
"células-tronco tumorais". Um pequeno grupo de CTT são essenciais para o crescimento
do tumor podendo compor um pequeno reservatório de células resistentes a drogas,
responsáveis por sua recidiva ou pela origem de metástases (Jordan et al., 2006).
O conceito de “Célula-tronco Tumoral” foi firmemente estabelecido em
experimentos utilizando células de Leucemia Mielóide Aguda (LMA). Nestes estudos,
uma pequena proporção de células indiferenciadas foi capaz de reconstituir o tumor in
vivo. Além da potente iniciação tumoral, essas células também apresentaram capacidade
de auto-renovação e de diferenciação (Bonnet & Dick, 1997). Desde então, CTTs têm
sido encontradas em câncer do sistema sanguíneo, pâncreas, pele, mama e outros
(Jordan et al., 2006; Li et al., 2007). A maioria das células tronco tumorais são
resistentes a drogas e expressam marcadores típicos de células tronco (Zou, 2007).
14
Além disso, CTTs assemelham-se muito às Células Tronco Hematopoiéticas
(CTH) com relação aos marcadores de superfície celular, multipotencialidade e
novamente, pela propriedade de auto-renovação. A auto-renovação é uma propriedade
essencial de algumas células tumorais e os genes que regulam este processo em uma CT
normal também o fazem nas CTTs (Clarke, 2004).
Do ponto de vista clínico, células tronco leucêmicas (CTL) são de interesse
fundamental, uma vez que, elas são resistentes à maior parte dos tratamentos atuais,
como a irradiação e quimioterapia e provavelmente também sejam contra terapias alvo
como inibidores da tirosina quinase e imunoterapia (Reither et al., 2015).
Como já dito anteriormente, uma propriedade presente nas células tronco é que
elas expressam altos níveis de transportadores de drogas ABC específicos. Por exemplo,
altos níveis de ABCG2 são encontrados em células tronco hematopoiéticas; porém, isso
não ocorre em células sanguíneas maduras (Dean et al., 2005).
Células Tronco e Fatores de Transcrição
Para a auto-renovação, proliferação e diferenciação de CT e CTTs a ativação de
determinados genes é necessária. Dentre os vários marcadores associados à
pluripotência em células tronco, os fatores de transcrição Oct4, Nanog e Sox2 são
indispensáveis para a divisão de células tronco indiferenciadas, sem efeito sobre o
potencial de diferenciação e sem afetar sua capacidade de auto-renovação (Atari et al.,
2011).
Oct-4, também conhecido como Oct-3 ou POU5f1, apresenta um domínio POU
com habilidade para ligar a uma sequência octamêrica (ATGCAAAT) (Scholer et al.,
1989). É um regulador crítico de pluripotencialidade em embriões de mamíferos e em
células germinativas primordiais (Pesce et al., 1998). Além disso, Oct-4 é um gene
marcador específico para pluripotência. (Deyev & Polanovsky, 2004).
A família de fatores de transcrição Sox apresenta-se como um dos reguladores
mais importantes dos processos de desenvolvimento. Isto inclui, pelo menos, 30
membros diferentes, os quais são classificados em 10 subfamílias. A família Sox está
intimamente relacionada a proteinas do fator celular T, o qual também contem um
domínio HMG de ligação ao DNA (Schönitzer et al., 2014). O Sex-determining region
Y-box 2 (Sox2) é um membro desta superfamília. Oct4 e Sox2 se ligam ao DNA
cooperativamente.
15
Reconhecidamente, o caminho celular é definido por fatores de transcrição que
agem ativando ou reprimindo a expressão de genes. O fator de transcrição Oct4,
relacionado com a pluripotência das células tronco, controla essa característica de uma
maneira quantitativa. Níveis precisos de Oct4 direcionam as células tronco embrionárias
para três destinos distintos: a repressão de Oct4 induz perda da pluripotência e
diferenciação para trofectoderma; alta expressão causa diferenciação para endoderma e
mesoderma; um nível específico de OCT4 pode manter as células tronco em um estado
pluripotente. Considerando esses resultados, o Oct4 é considerado o maior regulador da
pluripotência (Niwa et al., 2000).
O gene humano Oct4 pode codificar três isoformas, designadas como Oct4A
(também chamado de Oct4), Oct4B e Oct4B1 (Atlasi et al., 2008; Lee et al., 2006). A
localização de cada isoforma difere dentro da célula. O Oct4A encontra-se localizado
dentro do núcleo das CTE; Oct4B é principalmente localizado no citoplasma de
linhagens celulares de câncer somático (Lee et al., 2006; Cauffman et al., 2006) e
Oct4B1 é muito expresso em célula pluripotente humana e não pluripotente
(Papamichos et al., 2009).
Utilizando-se o auxilio da bioinformática, tem ainda sido proposta a existência
de seis pseudogenes Oct4 (Pain et a., 2005). Pseudogenes são considerados como genes
não funcionais ou fragmentos de genes incapazes de traduzir uma proteína funcional
(Hirotsune et al., 2003; Suo et al., 2005). Os pseudogenes Oct4 identificados são
chamados de Oct4-pg1, Oct4-pg2, Oct4-pg3, Oct4-pg4, Oct4-pg5, e Oct4-pg6 (Pain et
al., 2005).
Mesmo sendo consideradas não funcionais pela maioria, alguns autores têm
relatado funções relacionadas às proteínas destes pseudogenes. De acordo com Suo et
al. (2005) os pseudogenes Oct4-pg1 e Oct4-pg5 são transcritos em câncer mas não em
células de carcinoma embrionário, fibroblastos e em tecidos normais de pele e músculo.
Esses autores ainda relacionam a transcrição desses pseudogenes em cânceres com a
regulação da atividade do gene Oct4.
Precursores
de
leucemia
mieloide
aguda
CD34+CD38-
tem
reduzida
sensibilidade à daunorrubicina in vitro e aumentada expressão de genes relacionados
com a resistência a múltiplas drogas (mrp/irp) (Costello et al., 2000). Marques e
colaboradores (2010) também encontraram marcadores de célula-tronco hematopoiética
16
nas linhagens de leucemia mieloide crônica, K562 e Lucena, com maior expressão de
Oct4 na linhagem Lucena.
Além do fator de transcrição Oct-4, o fator Nanog também tem sido relatado
como um gene chave para a manutenção da pluripotência, como mostra a capacidade de
diferenciação multi-linhagem e a auto-renovação perpetua das células que expressam
esse gene (Mitsui et al., 2003; Oh et al., 2005). Chambers et al., (2003) mostraram que
Nanog tem uma capacidade de manter um estado indiferenciado e também pluripotente
em CTE.
Além dos fatores relacionados com a característica de pluripotência, outros
genes também parecem estar relacionados com a diferenciação de células leucêmicas e
são sugeridos como alvos para o tratamento de LMC (Seke Etet et al., 2012). O
araquidonato 5-lipoxigenase (5-LO), codificado pelo gene Alox-5, cataliza os dois
primeiros passos da biossíntese de leucotrienos a partir do ácido araquidônico (Wang et
al., 2011). Leucotrienos são mediadores de respostas inflamatórias, que podem ser
formados em granulócitos, monócitos/macrófagos e outras células depois da
estimulação (Steinhilber et al., 1993).
O gene Alox-5 é considerado chave para a regulação da função de células tronco
leucêmicas, mas não em CTH normais de camundongos, assim este gene é marcador da
própria célula tumoral. Alox5 é super-regulado por BCR-ABL. A deficiência ou inibição
desse gene previne o início da LMC induzida por BCR-ABL, por afetar a diferenciação,
divisão celular e sobrevivência das células tronco leucêmicas, resultando em uma
inibição específica de célula-tronco leucêmica (Chen et al., 2009).
Esta função do gene Alox-5 parece ser específica para algumas leucemias, visto
que células HL60 indiferenciadas, linhagem celular de leucemia promielocítica, não
expressam o gene Alox-5. Após a diferenciação dessas células, a transcrição é
aumentada (Ponton et al., 1996). Por outro lado, a enzima Alox-5 foi inibida em células
de gliomas do tipo stem-like quando tratadas com o composto sintético Nordy, inibindo
a auto-renovação e induzindo a diferenciação (Wang et al., 2011).
Durante a diferenciação celular de algumas células tronco tumorais a expressão
de genes relacionados com a resistência celular parece ser alterada. Por exemplo, o
trabalho de Ohtsuki e colaboradores (2007) mostrou que vários transportadores do tipo
Abca5 foram encontrados em diversos tumores e tecidos. Também detectaram a
presença de Abcb1 e Abca5 em células de adenocarcinoma de colo pouco diferenciadas,
17
mas não Abcc1. Por outro lado, em células diferenciadas de adenocarcinoma de colo
não foi verificada a presença de mRNA de Abcb1 ou Abca5 e sim de Abcc1 e Abca2,
sugerindo que a indução de Abca5 junto com Abcb1 parece estar correlacionadas com o
estado de diferenciação em tumores de colo humano.
A presença de Abcb1, Abcg2 e CD133 é considerada, por alguns autores, como
um marcador de célula-tronco tumoral. Em câncer gástrico, a expressão desses genes
foi correlacionada com o grau de diferenciação. Em células de adenocarcinoma gástrico
humano pouco diferenciadas e na linhagem celular de câncer gástrico indiferenciada, a
presença de Abcb1, Abcg2 foi maior que em adenocarcionoma diferenciados e em
linhagens celulares de câncer gástrico (Jiang et al., 2012).
A expressão aumentada de Abcb1 e Abcg2 parece ser essencial para a
proliferação in vivo e a auto-renovação em células tronco neurais, célula-tronco
hematopoiética e célula-tronco pancreática. A diminuição da expressão de Abcb1 ou
Abcg2 é observada com a diferenciação em CTH e em célula-tronco neural, enquanto
que o aumento da expressão pode levar a um aumento na proliferação de células tronco
neurais (Lin et al., 2006).
A partir das reflexões acima citadas, aliadas ao conceito de plasticidade celular
como um processo gênico envolvido, entre outros mecanismos, na diferenciação celular,
duas perguntas nortearam o presente estudo:
As linhagens leucêmicas K562, Lucena e FEPS possuem processos de
diferenciação semelhantes?
Determinados marcadores de células tronco exercem influência na aquisição do
fenótipo de resistência a múltiplas drogas em células de LMC?
A resposta destas questões resultaram em dois artigos: “Cell differentiation and
the multiple drugs resistance phenotype in human erythroleukemic cells” e “Influence
of Oct4 pseudogene on MDR phenotype of erytroleukemic cells”.
18
Objetivos
Objetivo Geral:
O objetivo deste trabalho foi comparar a resposta de linhagens celulares
eritroleucêmicas, com ou sem o fenótipo de resistência celular a múltiplas drogas, à
diferenciação induzida com PMA e avaliar a relação do pseudogene Oct4-pg1 com a
resistência celular.
Objetivos específicos:
- Analisar a presença de megacariócitos nas linhagens K562 (não MDR) e Lucena
(MDR) de forma constitutiva e após tratamento com PMA (agente indutor de
diferenciação);
-Avaliar a expressão dos genes Oct4, Sox-2 e Nanog, fatores de transcrição responsáveis
pela característica de pluripotência em células tronco, após tratamento com PMA nas
linhagens K562 (não MDR) e Lucena (MDR);
-Avaliar a expressão do gene Mdr1, que codifica a glicoproteína P, nas linhagens K562
(não MDR) e Lucena (MDR) após tratamento com PMA;
-Avaliar a expressão do gene Alox-5, relacionado com a diferenciação de células
leucêmicas, nas linhagens K562 (não MDR) e Lucena (MDR) após tratamento com
PMA;
-Relacionar a expressão basal dos genes Alox-5, Mdr1, Oct4, Sox2 e Nanog entre
linhagens K562 (não MDR), Lucena (MDR) e FEPS (MDR);
- Avaliar a expressão dos genes Mdr1, Oct4, Sox-2 e Nanog, como também o
pseudogene Oct4-pg1 na linhagem Lucena silenciada para o pseudogene Oct4-pg1;
- Avaliar a expressão protéica de Oct4 e Mdr-1 na linhagem Lucena silenciada para o
pseudogene Oct4-pg1;
- Avaliar a sensibilidade da linhagem Lucena silenciada para o pseudogene Oct4-pg1 à
vincristina.
19
Artigo 1
Cell differentiation and the multiple drug resistance phenotype in human erythroleukemic
cells.
(Artigo a ser submetido à Journal of Cell Science)
20
Cell differentiation and the multiple drug resistance phenotype in human erythroleukemic
cells.
Michele Carrett-Dias a, Leda Karine Almeidaa, Juliano Lacava Pereirac, Daniela Volcan
Almeida b, Luis Fernando Marins b, Ana Paula de Souza Votto a*, Gilma Santos
Trindade a
a
Laboratório de Cultura Celular, Universidade Federal do Rio Grande - FURG, Rio
Grande, RS, Brazil.
b
Laboratório de Biologia Molecular, FURG, Rio Grande, RS, Brazil.
c.
Laboratório de Patologia, Faculdade de Medicina (FaMed), FURG, Rio Grande, RS.
* Corresponding author: Votto, A. P. S. Universidade Federal do Rio Grande - FURG,
Instituto de Ciências Biológicas, Av. Itália, Km 8, 96201-900, Rio Grande, RS, Brazil.
E-mail: [email protected]
21
Abstract
The gene expression of Oct-4, a transcription factor and hematopoietic stem cell
marker, is higher in Lucena lines, which is MDR, and the gene Alox-5 has also been
implicated in the differentiation of some cell lines. The aim of this study was to
compare the response to PMA-induced differentiation in MDR and non-MDR cells. We
observed the differentiation to megakaryocytes in the K562 cell line, which is nonMDR. The expression of Alox-5 and Nanog genes was downregulated and that of Mdr-1
was upregulated in K562 cells. The Lucena cell line contained a higher number of
megakaryocytes than the non-MDR, but this number was not altered by PMA, as well
as Mdr-1 gene expression. However, Alox-5 expression was downregulated. Alox-5 and
Mdr-1 basal expression was also evaluated in the K562, Lucena and FEPS cell lines
(also MDR). The expression of Alox-5 was higher in the non-MDR cell line, while
FEPS had the lowest expression of this gene. The opposite pattern was observed for
Mdr-1 gene expression. These results suggest that the Alox-5 gene might play a role in
the differentiation of these cell lines.
Keywords: Leukemia, MDR, Alox-5, Differentiation, Tumoral stem cell
22
Introduction
Many studies have attempted to determine the relation between the cellular
processes involved in cancer and the presence of tumoral stem cells. This study was
designed to continue these efforts by examining parental erythroleukemic cells with the
characteristic of multiple drug resistance (MDR) as an experimental biological model,
focusing on the presence of stem cells and differentiation process.
The parental cell line K562 was derived from erythroleukemic cells obtained
from a woman diagnosed with chronic myeloid leukemia (CML). These cells contain
the Philadelphia chromosome (Ph1) (reciprocal translocation of chromosomes 9 and 22,
t(9,22)(q34;q11)), which generates the Bcr–Abl fusion gene encoding a constitutively
active tyrosine kinase (Seke Etet et al., 2012). This cell line present mieloblasts as
cellular type (Lozzio and Lozzio, 1975) and it is one of the most studied cell lines used
in leukemia research. To induce a resistant erythroleukemic cell line, Rumjanek et al.
(1994; 2001) established a model in vitro using the cell line K562, selecting for
resistance with the chemotherapeutic vincristine (Tsuruo et al., 1983), thus developing a
comparative experimental model for multiple drug resistant cells. The name given to the
MDR cell line was K562-Lucena1 (Lucena), to avoid confusion with the parental cell
line K562. Recently, the same group produce another cell line derived from K562 using
the chemotherapeutic daunorubicin. The new MDR cell line, named FEPS, has different
characteristics from Lucena, such as lower expression of the cellular death receptor
CD95, higher expression of P glycoprotein (P-gp) and the presence of another protein
related to the MDR phenotype, ABCC1 (Daflon-Yunes et al., 2013).
Many factors can lead to the MDR phenotype, but the superexpression of P-gp
is the most studied mechanism. The gene MDR1 (or ABCB1) encodes P-gp (Sonneveld
and Wiemer, 1997). P-gp is a glycoprotein with a molecular mass of almost 170 KDa. It
is a member of the ATPase family (superfamily ABC – ATP biding cassette) expressed
in the cell membrane, where it functions as an energy-dependent efflux mechanism to
pump chemotherapeutic agents out of the cell (Uchiumi et al., 1993). In addition to
neoplastic cells, a variety of non-tumoral human tissues express different levels of this
glycoprotein (Schinkel, 1997). The MDR phenotype induced by different drugs can
involve the superexpression of different genes, but among these, the most commonly
23
involved are ABCB1, ABCG2 and ABCC1, already identified in tumoral cells (Kim et
al., 2002; Scharemberg et al., 2002).
Marques et al. (2010) identified hematopoietic stem cells (HSCs) in the leukemic
cell lines K562 and Lucena due the presence of the phenotype CD34+CD38(hematopoietic stem cells markers). These authors also have shown that the promoter
region of the ABCB1, ABCG2 and ABCC1 genes contains binding sites for the
transcription factor Oct-4, which is also a tumoral stem cell (TSC) marker. The cell line
Lucena has a higher expression of the gene Oct-4, indicating that this cell line probably
presents more aggressive and invasive characteristics compared to its parental cell line
K562.
The concept of the “tumoral stem cell” was coined during experiments using
Acute Myeloid Leukemia (AML) cells. In these studies, a small proportion of
undifferentiated cells were able to reconstruct the tumor in vivo. In addition to the
potent tumoral initiation, these cells also contain an auto-renewal and differentiation
capacity (Bonnet and Dick, 1997). Additionally, TSCs are very similar to hematopoietic
stem cells in terms of cell surface markers, multipotentiality and, as already mentioned,
auto-renewal ability. Some authors consider that auto-renewal is an essential
characteristic of some tumoral cells, and the genes responsible for regulating this
process in a normal stem cell (SC) are the same in TSCs (Clarke, 2004).
From the clinical point of view, leukemic stem cells (LSCs) are of fundamental
importance once they are resistant to most of the current treatments for cancer, such as
irradiation and chemotherapy, and probably also resistant to targeted therapies, such as
tyrosine kinase inhibitors and immunotherapy (Reither et al., 2015). The state of the
embryonic pluripotent stem cell is associated with specific transcriptional factors such
as Oct-4, Sox-2 and Nanog (Chambers and Tomlinson, 2009). These factors are
essential for the cell division of undefined stem cells, with no known effect on
differentiation potential or auto-renewal capacity (Atari et al., 2011). Alterations in the
expression of these genes can define the differentiation, dedifferentiation or autorenewal of embryonic stem cells (Chambers et al., 2003; Karwacki-Neisius, et al., 2013;
Niwa et al., 2000; Rodda et al., 2005).
Other genes also are involved in the differentiation of leukemic cells. The gene
encoding for arachidonate 5-lipoxygenase (5-LO) (ALOX-5) has a key role in the
regulation of leukemic stem cell functions, but not in normal hematopoietic stem cells
24
from mice, which makes this gene a marker of its own tumoral cell. Additionally, Alox5
is upregulated by BCR-ABL, and a deficiency or inhibition of this gene prevents the
start of CML induced by BCR-ABL by affecting differentiation, cell division and
leukemic stem cell survival (Chen et al., 2009). The enzyme Alox-5 was inhibited in
glioma stem-like cells treated with the synthetic compound Nordy, causing an inhibition
of auto-renewal and inducing differentiation (Wang et al., 2011). Biologically, Alox-5
acts mainly as a rate-limiting enzyme in leukotriene synthesis during the metabolic
processing of arachidonic acid (Wang et al., 2011).
Considering the continual seeking for improved treatment, or even the cure, of
cellular disorders such as cancer, cell differentiation has been recognized as an
alternative therapy. In advanced stages, CML presents alterations that restrict
differentiation (Melo and Barnes, 2007). Therefore, the aim of the present study was to
compare the response to phorbol 12-myristate 13-acetate (PMA)-induced differentiation
of MDR and non-MDR cells.
Results
Treatment with high PMA concentrations results in cytotoxicity in MDR and non-MDR
cell lines
The cell viability of the K562 line is presented in Fig. 1A,B, and for the Lucena
line in Fig. 1C,D. Treatment with PMA at 0.1 and 1 nM did not affect the viability of
either cell line. In the non-MDR K562 cell line, cytotoxicity was observed at the higher
PMA concentrations (10, 100 and 1000 nM) since the 24 h of treatment. Cytotoxicity
was observed at the two higher concentrations in the MDR cell line Lucena since 48 h.
On the other hand, PMA at 10 nM inhibited Lucena cell line proliferation with no loss
of cell viability. These results sugest that PMA interfere either in cell viability and in
cellular proliferation.
Based on these results, PMA at 10 nM was chosen for most of the remaining
experiments because it was the lowest concentration affecting both cell lines.
25
Treatment with PMA induced megakaryocyte differentiation in the cell line K562 but
not in Lucena.
The presence of megakaryocytes was determined by cellular morphology (Fig.
2). PMA at 1 nM did not alter the number of megakaryocytes in the cell lines K562 and
Lucena (Fig. 2E). On the other hand, PMA at 10 nM increased the number of
megakaryocytes in the cell line K562 (Fig. 2A,B) compared to cells from the control
group (Fig. 2E). In the Lucena cell line, although also present in control cells (Fig. 2E),
an increase in the number of megakaryocytes after treatment with PMA was not
observed (Fig. 2C,D). The frequency of megakaryocytes in the Lucena cell line was
higher than in the parental cell line (Fig. 2E). When verapamil was used as an inhibitor
of the efflux pump ABCB1, an increase in megakaryocytes in the Lucena cell line
treated with PMA was also not observed (Fig. 3A).
PMA serves as a substrate for the efflux pump in the Lucena cell line
The activity of ABCB1 was evaluated in the Lucena cell line by using
Rhodamine 123. Lucena cells exposed to the dye were able to extrude it, exhibiting a
fluorescence value similar to cells not exposed to Rhodamine 123. The fluorescence of
cells treated with PMA and receiving Rhodamine 123 was not different from those
receiving only the dye or PMA (Fig. 3B). The K562 cells treated with Rhodamine 123
were more fluorescent compared to their respective control. The viability of Lucena
cells treated with verapamil and/or vincristine and/or PMA at 10 nM was also evaluated
(Fig. 3C). Verapamil was used to inhibit ABCB1 activity. Upon inhibition, the Lucena
cell line was exposed to vincristine. Once vincristine was used in the maintenance of
MDR in this cell line, treatment with this chemotherapeutic alone had no effect.
Cytotoxicity was observed at 72 h in treatments with PMA at 10 nM or the combination
of verapamil and vincristine. The treatment with PMA and vincristine also caused
cytotoxicity at 72 h of treatment. However, the combination of verapamil and PMA
caused cytotoxicity since 48 h of treatment.
Gene expression of Oct-4, Sox-2, Nanog, Alox-5 and MDR1 in cells treated with PMA
The gene expression of Oct-4 and Sox-2, which play a role in the characteristics
of stem cells like of K562 cell line (Fig. 4A), was not altered during the treatment with
PMA 10 nM. However, incubation with PMA for 24 h significantly reduced the
26
expression of Nanog. The treatment also reduced Alox-5 gene expression and induced a
higher expression of Mdr1 gene (which encodes for ABCB1). On the other hand, in the
Lucena cell line, incubation with PMA significantly reduced only Alox-5 gene
expression, and did not alter the gene expression of Nanog, Oct-4 and Sox-2 (Fig. 4B).
Alox-5 and Mdr1 gene expression is inverted in K562, Lucena and FEPS cells
The gene expression of Alox-5 and Mdr1 in the cell lines K562, Lucena and
FEPS without treatment with PMA is shown in Fig. 4C. The expression of Alox-5 is
significantly different among the cell lines. K562 shown the higher expression and
FEPS the lower. For Mdr1 the expression profile was reversed, K562 shown the lower
expression and FEPS the higher gene expression. The Lucena cell line presented an
intermediate expression compared to K562 and FEPS.
Discussion
This study analyzed the relation between cell differentiation and the phenotype
of resistance to multiple drugs in erythroleukemic cells, intending to advance the state
of knowledge in the cancer field by seeking a better understanding of these processes.
Without doubt, the phenotype MDR is one of the main causes of failure in the treatment
of cancer, and within the pursuit of treatment for this cellular disorder, promoting cell
differentiation has been considered as an alternative therapy (Melo and Barnes, 2007).
Based on studies showing that treatment with PMA induces megakaryocytic
differentiation in the K562 cell line (Herrera et al., 1998; Hirose et al., 2013; Huo et al.,
2006; Murray et al., 1993), this substance was used in this study. The choice of PMA
concentrations (Fig. 1) was determined based on a curve. In the referenced studies, the
PMA concentrations varied. We found that 10 nM of PMA was cytotoxic for the nonMDR cell line K562, while for Lucena this concentration only inhibited its cell
proliferation. Chen and co-workers (2011) reported the inhibition of proliferation in
K562 cells treated with PMA at 80 nM and related this inhibition to the increase in
apoptosis. The treatment of these cells with PMA also resulted in a loss of cell growth;
polyploidy; morphological changes; and an increase in cell-to-cell and cell-to-substrate
adhesion (Butler et al., 1990; Colamonici et al., 1985; Fukuda 1981; Hocevar et al.,
1992; Long et al, 1990; Tetteroo et al., 1984). In this study, 10 nM of PMA induced the
27
differentiation of K562 cells into megakaryocytes, although in the MDR cell line
Lucena, differentiation into megakaryocytes was not observed, allowing us to consider a
variety of factors.
According to Hirose et al. (2013), the intracellular accumulation of reactive
oxygen species is involved in the megakaryocyte differentiation induced by PMA in
leukemic K562 cells. Trindade et al. (1999) and Votto et al. (2007; 2010) have shown
that Lucena cells have a higher activity of antioxidant enzymes than the K562 cell line,
suggesting a lower intracellular accumulation of reactive oxygen species in the MDR
cell line, which could be responsible for inhibiting the induction of differentiation in
this type of cell. Another factor that could explain this result could be the activity of the
efflux pump in the MDR cell line, which could be extruding PMA from these cells.
Lucena cells express the ABCB1 gene, which encodes the protein P-gp, at levels nearly
1400 times higher than the parental K562 cell line (Marques et al., 2010). It was
possible to determine in this study that the protein P-gp was not inhibited by PMA
treatment because it was unable to increase the fluorescence of cells treated with
Rhodamine 123 (Fig. 3B). However, when associated with vincristine, it caused similar
toxicity to that observed in the treatment solely with PMA or vincristine combined with
verapamil. However, the combination of PMA and verapamil was cytotoxic at 48 h of
treatment (Fig. 3C). Therefore, PMA might be a substrate for this efflux pump.
However, when P-gp was blocked with verapamil, no significant increase in
megakaryocytes was observed in the Lucena cell line when treated with PMA. In this
case, verapamil could be blocking the differentiation process, perhaps by blocking the
calcium channels (Fleckenstein, 1983). Calcium is required in the protein kinase C
(PKC) signaling cascade, which participates in the differentiation process (Murray et al.,
1993).
Those
authors
have
shown
that
PMA-induced
differentiation
into
megakaryocytes in K562 cells involves the activation of a specific isoform of PKC,
which requires the activity of the signaling complex MEK/ERK to regulate the blockage
of the cell cycle, leading to the expression of cell surface markers associated with this
differentiation (Herrera et al., 1998).
The activation of PKC by PMA simulates the action of diacylglycerol, which is
produced from inositol phospholipids initiated by the ligation of many growth factors
and ligands from its cellular receptors (Nishizuka, 1992). However, according to
Fleckenstein (1983), verapamil blocks the L-type voltage-gated calcium channels, and
28
the calcium used in PKC signaling might originate from the endoplasmic reticulum
through the fixation of inositol triphosphate (IP3) to the IP3 activated calcium channel,
when the signaling pathway of the phospholipid inositol is activated (Alberts et al.,
1997). The results of Fig. 3A colaborate with this information, therefore eliminating the
influence of verapamil in this study.
Another possibility is that PMA does not induce the differentiation into
megakaryocytes in the Lucena cell line, but rather induces its differentiation into
another cell type, such as erythrocytes, for example. Indeed, during the normal
differentiation process of myeloblasts (remembering that this is the cell type of the
studied cell line), the progenitor of this cell line is common to the erythroid and
megakaryocytic lineages. This type of progenitor cell was identified in the cell lines
K562 and Lucena because both present hematopoietic stem cell markers (phenotype
CD34+CD38-) (Marques et al., 2010).
Concerning the transcription factors, the expression of Oct-4, Sox-2 and Nanog
confirms the presence of stem cell populations in the K562 and Lucena cell lines.
Decrese of Nanog and Alox-5 gene expression was observed in the K562 cells treated
with PMA. This observation may explain the cell differentiation. Nanog is
downregulated during the differentiation of embryonic stem cells (Chambers et al.,
2003), and according to Wu and Yao (2005), there are no records of Nanog expression
in differentiated cells. A reduction in Alox-5 gene expression was also observed in the
Lucena cell line, suggesting a differentiation process induced by PMA incubation, but
probably not following the megakaryocyte differentiation pathway.
Wang and collaborators (2011) studied the synthetic compound Nordy and
observed inhibition of the enzyme Alox-5 and attenuated growth of glioma stem-like
cells (GSLCs). Nordy also inhibited the auto-renewal and induced GSLCs
differentiation in vitro and in vivo. In this same study, a reduction in the gene expression
of transcription factors associated with the stem cell state (Nanog, Oct-4 and Sox-2) was
observed, suggesting that the transcription of these genes was attenuated in the
astrocytic differentiation process.
The fact that the expression of some transcription factors was unaltered in the
present study may be explained by the study of Oliveira and colleagues (2015), in which
different mutations of the gene Oct-4 were identified in the K562 and Lucena cell lines.
29
Chen et al. (2009) suggested that Alox-5 is involved in cellular differentiation.
According to those authors, the Alox-5 gene appears to be a key target to attenuate the
injuries caused by CML. The authors demonstrated that this gene might play an
important role in the functional regulation of leukemic stem cells. In that same study,
the deficiency of the Alox-5 gene in mice caused an impairment of LSCs function but
not of normal hematopoietic stem cells. Recent progress in cancer biology indicates that
the eradication of tumoral stem cells is essential for a more effective therapy. Therefore,
the inhibition of this gene is associated with cell differentiation, returning a non-tumoral
characteristic to tumoral cells.
The Lucena MDR cell line had a higher expression of the stem cell marker gene
Oct-4, indicating that this line probably presents more aggressive and invasive
characteristics than its parental line K562. Therefore, the presence of a higher number
of undifferentiated cells and the MDR characteristic in the Lucena lineage may be
responsible for the difficulty in finding therapeutic alternatives for CML.
To better understand the relation between differentiation and the cell resistance
phenotype, this work presents a comparative study of Alox-5 and Mdr1 gene expression
in the K562, Lucena and FEPS cell lines.
Interestingly, the results reveal an inverted expression profile for the genes Alox5 and Mdr1 in the different lineages. The data presented in Fig. 4C show that the higher
the Alox-5 expression, the lower the Mdr1 expression. These data are in accordance
with those of Moreira and co-workers (2014), who have shown by microarray that Mdr1
expression is 287.62 higher in Lucena compared to the K562 lineage. When the
expression of the same gene was compared between K562 and FEPS cell lines, FEPS
presented an overexpression of 1759.56 compared to the parental line. When the
expression of Alox-5 was compared between K562 and FEPS cell lines, the resistant
lineage underexpressed the gene 454.14. When the cell line K562 was treated with
PMA, the proportion was inverted. PMA treatment increased Mdr1 and decreased Alox5 gene expression. Therefore, the reduction in Alox-5 expression appears to be
associated with differentiation in these cells.
However, the Lucena cell line, with a lower Alox-5 gene expression, has a higher
number of megakaryocytes with no PMA treatment compared to K562 under the same
conditions. Therefore, it is possible that the MDR lineage, with a higher number of stem
cells (Marques et al., 2010), has a higher differentiation potential.
30
Material and Methods
Cell lines and culture conditions
K562 cell line were obtained from the Rio de Janeiro Cell Bank (Brazil) and
Lucena cell line were obtained from the Tumoral Immunology Laboratory at the
Medical Biochemistry Institute of the Federal University of Rio de Janeiro, Brazil. The
FEPS cell line was obtained from the Tumoral Immunology Laboratory at the Medical
Biochemistry Institute of the Federal University of Rio de Janeiro (Brazil). The cells
were grown at 37ºC in 5% CO2 in disposable plastic flasks containing RPMI1640
(Gibco, São Paulo, Brazil) medium supplemented with sodium bicarbonate (0.2 g/L)
(Vetec, Rio de Janeiro, Brazil), L-glutamine (0.3 g/L) (Vetec), Hepes (25 mM) (Acros,
Belgium), fetal bovine serum (FBS-10%; Gibco), 1% antibiotic (penicillin –100 U/mL),
streptomycin (100 mg/mL) (Gibco) and antimycotic (amphotericin-B 0.25 mg/mL –
Sigma, São Paulo, Brazil). Lucena and FEPS were maintained with 60 nM of vincristine
(VCR) (Sigma) and 300 nM of daunorubicin (DNR) (Sigma), respectively.
Treatment of cells with PMA
The cells K562, Lucena and FEPS were grown for 2, 3 and 4 days before the
beginning of the all experiments, respectively (Trindade et al., 1999; Daflon-Yunes et
al., 2013). The cells were then centrifuged, washed twice with PBS (Ca+2–Mg+2-free),
re-suspended in RPMI 1640 medium and maintained in 24-well culture plates (to 5×105
cells/mL). For cell differentiation, a stock solution of phorbol 12-myristate 13-acetate
(PMA) (Sigma) in dimethyl sulfoxide (DMSO) (Synth) was prepared and diluted in
medium to the concentrations of 0.1, 1, 10, 100 and 1000 nM of PMA. The control cells
(not treated) received DMSO at 0.06% (final concentration used in the treatment with
the higher PMA concentration). In some of the experiments, the classic inhibitor of P
glycoprotein, Verapamil (VP), was used at 5 µM and the chemotherapy drug VCR at 60
nM.
Cell viability assay
Cell viability was determined by trypan blue exclusion assay immediately (0 h),
24, 48 and 72 h after incubation with PMA in K562 and Lucena cells. The cell viability
31
of the Lucena lineage treated with PMA was also analyzed in the presence of verapamil
or vincristine.
Cytology
The cells K562 and Lucena (5×105 cells/mL) were treated with PMA at 1 or 10
nM and then incubated for 48 or 24 h, respectively. Lucena cells were also treated with
PMA at 10 nM and verapamil. The volume of 1.2 mL of the resuspended samples was
concentrated by sedimentation for 1 h at environment temperature in 1.5 mL
microtubes. Then, using a micropipette, 50 µL from the precipitate was transferred to a
microscope slide and spread unilaterally. After drying at environment temperature, the
cells were stained with the panoptic dye for hematology (Laborclin).
The slides were analyzed by optical microscopy (Olympus® BX 51; América
INC., São Paulo, Brazil) using an ocular lens with 10x magnification and a 100x
objective and the software Image J for image pixel analyze in the images. The images
were documented using a photographic camera (Olympus® DP72; América Inc., São
Paulo, Brazil).
The megakaryocyte frequency in the slides was evaluated by identifying these
cells based on the normal morphology of mature cells and then dividing by the total of
cells analyzed. This analysis was undertaken using the software Microsoft Office
Picture Manager.
Rhodamine 123 extrusion
To analyze the P-gp efflux pump activity, the Lucena cells (5×105 cells/mL)
were treated with PMA at 10 nM and incubated for 24 h. Subsequently, the cells were
centrifuged (1100 rpm for 2 min) and washed with PBS. Rhodamine 123 (Sigma) (300
ng/mL) and culture media were added followed by incubation for 60 min. Then, the
medium containing Rhodamine 123 was removed and culture medium alone was added
for an additional 60 min incubation. Finally, the medium was removed and the cells
were resuspended in PBS. Excitation/ emission values were determined using a
multiwell plate reader (ELX 800 Universal Microplate Reader; Bio-TEK) at 485/590
nm.
32
Gene expression
The cells K562 and Lucena were treated with 10 nM of PMA during 24 hs for
gene expression analysis of Oct-4, Sox-2, Nanog, Mdr-1 and Alox-5. The cell lines
K562, Lucena and FEPS were analyzed without PMA treatment to compare the basal
expression of Mdr-1 and Alox-5. Total RNA was extracted from six samples of each cell
line (2×106 cells per sample) according to the manufacturer’s protocol for TRIzol
Reagent (Invitrogen, Brazil), and quantified by fluorometry in a QubitTM fluorometer
using the Quanti-iTTM RNA Assay Kit (Invitrogen, Brazil). The RNA integrity was
determined by electrophoresis in a 1.5% agarose gel stained with ethidium bromide (0.5
µg/mL). The cDNA synthesis was performed by reverse transcription of 2 µg RNA
using the High Capacity cDNA Reverse Transcriptase Kit (Applied Biosystems, Brazil).
Gene expression analysis was performed by real-time quantitative PCR (qPCR). Genespecific primers (Table 1) were designed based on sequences available in GenBank
using the Primer Blast tool (http://www.ncbi.nlm.nih.gov). Previously, the PCR
amplification efficiency of each primer pair was evaluated by serial dilution reactions
where the efficiency of reactions showed the appropriate parameters (Table 1). Ef1a and
βactin were chosen as reference genes after stability was confirmed with the geNorm
applet (Vandesompele et al. 2002). For gene expression, each sample was analyzed in
triplicate using the ABI 7500 platform Real Time Systems (Applied Biosystems, Brazil)
and the detection system Platinum SYBR Green qPCR SuperMix (Invitrogen, Brazil).
The normalization factor was calculated as the geometric mean of the expression values
of the reference genes tested by the geNorm applet. Relative expression levels of the
target genes were calculated by dividing the expression value of the target gene by the
normalization factor.
Statistical analysis
The data normality and variance homogeneity were previously tested. Analysis
of variance (ANOVA) followed by Tukey’s post hoc test was applied to all analyses,
except for gene expression, when the t-test was used. The results are expressed as the
mean±S.E.M. Each experiment was performed three times in triplicate in each
experiment and the significance level was fixed at p<0.05.
33
Acknowledgements
The authors would like to thank Dr. Vivian Rumjanek (Tumoral Immunology
Laboratory at the Medical Biochemistry Institute of the Federal University of Rio de
Janeiro, Brazil) for providing the Lucena and FEPS cell lines.
Competing interests
The authors declare no competing or financial interests.
Author contributions
M.C.D. maintained the cell lines, performed the Rhodamine 123 extrusion, prepared the
RNA samples, ran quantitative real-time PCR, analyzed data, wrote the manuscript and
prepared figures; L.K.A. maintained the cell lines, executed the cell line assays and
prepared the cells for histological analysis; J.L.P. prepared the slides and undertook the
morphological analysis of the resulting images; D.V.A. prepared the RNA samples, ran
quantitative real-time PCR, analyzed data, contributed to the manuscript writing and
prepared tables; L.F.M. contributed by providing real-time PCR reagents, analyzing
data and helping with the manuscript writing; A.P.S.V. analyzed data and contributed to
the manuscript writing; and G.S.T. analyzed data and contributed to the manuscript
writing.
Funding
This work was supported by the Brazilian agencies: CNPq (Conselho Nacional de
Desenvolvimento Científico e Tecnológico) and CAPES (Coordenação de
Aperfeiçoamento de Pessoal de Nível Superior).
34
References
Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts, K. and Watson, J. D. (1997).
Biologia molecular da célula. 3ed. Porto Alegre: Artes Médicas.
Atari, M., Barajas, M., Hernández-Alfaro, F., Gil, C., Fabregat, M., Padró, E.F.,
Giner, L. and Casals, N. (2011). Isolation of pluripotent stem cells from human third
molar dental pulp. Histol. Histopathol. 26, 1057-1070.
Bonnet, D. and Dick, J.E. (1997). Human acute myeloid leukemia is organized as a
hierarchy that originates from a primitive hematopoietic cell. Nat. Med. 3, 730–737.
Butler, T. M., Ziemiecki, A. and Friis, R. R. (1990). Megakaryocytic differentiation
of K562 cells is associated with changes in the cytoskeletal organization and the pattern
of
chromatographically
distinct
forms
of
phosphotyrosyl-specific
protein
pathphosphatases. Cancer Res. 50, 6323–6329.
Chambers, I. and Tomlinson, S. R. (2009). The transcriptional foundation of
pluripotency. Development 136, 2311-2322.
Chambers, L., Colby, D., Robertsom, M., Nichols, J., Lee, S., Tweedie, S. and
Smith, A. (2003). Functional expression cloning of nanog, a pluripotency sustaining
factor in embryonic stem cells. Cell 113, 643-655.
Chen, Y., Hu, Y., Zhang, H., Peng, C. and Li, S. (2009). Loss of the Alox5 gene
impairs leukemia stem cells and prevents chronic myeloid leucemia. Nat. Genet. 41,
783-793.
Chen, Y., Sullivan, C., Peng, C., Shan, Y., Hu, Y., Li, D. and Li, S. (2011). Atumor
suppressor function of the Msr1 gene in leukemia stem cells of chronic myeloid
leucemia. Blood 118, 390-400.
Clarke, M. F. (2004). Neurobiology: at the root of brain cancer. Nature 432, 281-282.
Colamonici, O. R., Trepel, J. B., and Neckers, L. M. (1985). Phorbol ester enhances
deoxynucleoside incorporation while inhibiting proliferation of K-562 cells. Cytometry
6, 591–596.
Daflon-Yunes, N., Pinto-Silva, F. E., Vidal, R. S., Novis, B. F., Berguetti, T., Lopes,
R. R. S., Polycarpo, C. and Rumjanek, V. M. (2013). Characterization of a multidrugresistant chronic myeloid leukemia cell line presenting multiple resistance mechanisms.
Mol. Cell Biochem. 383, 123–135.
Fleckenstein, A. (1983). History of calcium antagonists. Circ. Res. 52, 3-16.
35
Fukuda, M. (1981). Tumor-promoting phorbol diester-induced specific changes in cell
surface glycoprotein profile of K562 human leukemic cells. Cancer Res. 41, 4621–
4628.
Herrera, R., Hubbell, S., Decker, S. and Petruzzelli, L. (1998). A Role for the
MEK/MAPK pathway in PMA-induced cell cycle arrest: modulation of megakaryocytic
differentiation of K562 cells. Exp. Cell Res. 238, 407–414.
Hirose, K., Monzen, S., Sato, H., Sato, M., Aoki, M., Hatayama, Y., Kawaguchi,
H., Narita, Y., Takai, Y. and Kashiwakura, I. (2013). Megakaryocytic differentiation
in human chronic myelogenous leucemia K562 cells induced by ionizing radiation in
combination with phorbol 12-myristate 13-acetate. J. Radiat. Res. 54, 1–9.
Hocevar, B. A., Morrow, D. M., Tykocinski, M. L. and Fields, A. P. (1992). Protein
kinase C isotypes in human erythroleukemia cell proliferation and differentiation. J.
Cell Sci. 101, 671-679.
Huo, X. F., Yu, J., Peng, H., Du, Z. -W., Liu, X. L., Ma, Y. –N., Zhang, X., Zhang,
Y., Zhao, H. Lu. and Zhang, J. W. (2006). Differential expression changes in K562
cells during the hemin-induced erythroid differentiation and the phorbol myristate
acetate (PMA)-induced megakaryocytic differentiation. Mol. Cell Biochem. 292, 155–
167.
Kim, M., Turnquist, H., Jackson, J., Sqaqias, M., Yan, Y., Gonq, M., Dean, M.,
Sharp, J.G. and Cowan, K. (2002). The multidrug resistance transporter ABCG2
(breast cancer resistance protein 1) effluxes Hoechst 33342 and is overexpressed in
hematopoietic stem cells. Clin. Cancer Res. 8, 22-28.
Karwacki-Neisius, V., Göke, J., Osorno, R., Halbritter, F., Ng, J. H., Weiße, A. Y.,
Wong, F. C. K., Gagliardi, A., Mullin, N. P., Festuccia, N., et al. (2013). Reduced
Oct4 expression directs a robust pluripotent sState with distinct signaling activity and
increased enhancer occupancy by Oct4 and Nanog. Cell Stem Cell 12, 531–545.
Long, M. W., Heffner, C. H.,Williams, J. L., Peters, C. and Prochownik, E. V.
(1990). Regulation of megakaryocyte phenotype in human erythroleukemia cells. J.
Clin. Invest. 85, 1072–1084.
Lozzio, C. B. and Lozzio, B. B. (1975). Human chronic myelogenous leukemia cellline with positive Philadelphia chromosome. Blood 45, 321–334.
36
Marques, D. S., Sandrini, J. Z., Boyle, R. T., Marins, L. F. and Trindade, G. S.
(2010). Relationships between multidrug resistance (MDR) and stem cell markers in
human chronic myeloid leukemia cell lines. Leukemia Res. 34, 757–762.
Melo, J. V. and Barnes, D. J. (2007). Chronic myeloid leukaemia as a model of
disease evolution in human cancer. Nat. Rev. Cancer 7, 441–53.
Moreira, M. A. M., Bagni, C., Pinho, M. B., Mac-Cormick, T. M., Mota, M. S.,
Pinto-Silva, F. E., Daflon-Yunes, N. and Rumjanek, V. M. (2014). Changes in gene
expression profile in two multidrug resistant celllines derived from a same drug
sensitive cell line. Leuk. Res. 38, 983-987.
Murray, N. R., Baumgardner, G., P., Burns, D. J. and Fields, A. P. (1993). Protein
kinase C isotypes in human erythroleukemia (K562) cell proliferation and
differentiation. J. Biol. Chem. 268, 15847-15853.
Nishizuka, Y. (1992). Intracellular signaling by hydrolysis of phospholipids and
activation of protein kinase C. Science 258, 607-614.
Niwa, H., Miyazaki, J. and Smith, A.G. (2000). Quantitative expression of Oct-3/4
defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24,
372-376.
Oliveira, B. R., Figueiredo, M. A., Trindade, G. S. and Marins, L. F. (2015). OCT4
mutations in human erythroleukemic cells: implications for multiple drug resistance
(MDR) phenotype. Mol. Cell. Biochem. 400, 41–50.
Riether, C., Schürch, C. M. and Ochsenbein, A. F. (2015).
Regulation of
hematopoietic and leukemic stem cells by the immune system. Cell Death Differ. 22,
187–198.
Rodda, D. J., Chew, J. L., Lim, L. H., Loh, Y. H., Wang, B., Ng, H. H. and
Robson, Paul. (2005). Transcriptional Regulation of Nanog by OCT4 and SOX2. J.
Biol Chem. 280, 24731–24737.
Rumjanek, V. M., Lucena, M., Campos, M. M., Marques-Silva, V. M. and Maia, R.
C. (1994). Multidrug resistance in leukemias: the problem and some approaches to its
circumvention. Ciência e Cultura J. Braz. Assoc. Adv. Sci. 46, 63–69.
Rumjanek, V. M., Trindade, G. S., Wagner-Souza, K., Meletti-de-Oliveira, M. C.,
Marques-Santos, L. F., Maia, R. C. and Capella, M. A. M. (2001). Multidrugresistance in tumor cells: characterization of the multidrug resistant cell line K562Lucena 1. Ann. Acad. Bras. Cienc. 73, 57–69.
37
Scharenberg, C. W., Harkey, M. A. and Torok-Storb, B. (2002). The ABCG2
transporter is an efficient Hoechst 33342 efflux pump and is preferentially expressed by
immature human hematopoietic progenitors. Blood 99, 507-512.
Schinkel, A. H. (1997). The physiological function of drug-transporting Pglycoproteins. Semin. Cancer Biol. 8, 161-70.
Seke Etet, P. F., Vecchio, L. and Nwabo Kamdje, A. H. (2012). Signaling pathways
in chronic myeloid leukemia and leukemic stem cell maintenance: Key role of stromal
microenvironment. Cell. Signal. 24, 1883-1888.
Sonneveld, P. and Wiemer, E. (1997). Assays for the analysis of P-glycoprotein in
acute myeloid leukemia and CD34 subsets of AML blasts. Leukemia 11, 1160-1165.
Tetteroo, P. A. T., Massaro, F., Mulder, A., Schreuder-van Gelder, R. and Kr. von
dem Borne, A. E. G. (1984). Megakaryoblastic differentiation of proerythroblastic
K562 cell-line cells. Leuk. Res. 8, 197–206.
Trindade, G. S., Capella, M. A. M., Capella, L. S., Affonso-Mitidier, O. R. and
Rumjanek, V. M. (1999). Differences in sensitivity to UVC, UVB and UVA radiation
of a multidrug-resistant cell line overexpressing P-glycoprotein. Photochem. Photobiol.
69, 694–699.
Tsuruo, T., Iida, H., Ohkochi, E., Tsukagoshi, S. and Sakurai, Y. (1983).
Establishment and properties of a vincristine-resistant human myelogenous leukemia
K562. Jpn. J. Cancer 74, 751-758.
Uchiumi, T., Kohno, K., Tanimura, H., Matsu, K., Sato, S., Uchida, Y. and
Kuwano, M. (1993). Enhanced expression of the human multidrug resistance 1 gene in
response to UV light irradiation. Cell Growth Differ. 4, 147-157.
Vandesompele, J.,De Preter, K.,Pattyn, F.,Poppe, B.,Van Roy, N.,De Paepe, A.
andSpeleman, F. (2002). Accurate normalization of real-time quantitative RT-PCR
data by geometric averaging of multiple internal control genes. Genome Biol. 3, 1-11.
Votto, A. P. S., Renon, V. P., Yunes, J. S., Rumjanek, V. M., Capella, M. A. M.,
Moura- Neto, V., Freitas, M. S., Geracitano, L. A., Monserrat, J. M. and Trindade,
G. S. (2007). Sensitivity to microcystins: A comparative study in human cell lines with
and without multidrug resistance phenotype. Cell Biol. Int. 31, 1359-1366.
Votto, A. P. S., Domingues, B. S., Souza, M. M., Silva Júnior, F. M. R., Caldas, S.
S., Filgueira, D. M. V. B., Clementin, R. M., Primel, E. G., Vallochi, A. L., Furlong,
38
E. B., et al. (2010). Toxicity mechanisms of onion (Allium cepa) extracts and
compounds in multidrug resistant erythroleukemic cell line. Biol. Res. 43, 429-437.
Wang, B., Yu, S. C., Jiang, J.Y., Porter, G. W., Zhao, L. T., Wang, Z., Tan, H.,
Cui, Y.H., Qian, C., Ping, Y. F., et al. (2011). An inhibitor of arachidonate 5lipoxygenase, Nordy, induces differentiation and inhibits self-renewal of glioma stemlike cells. Stem Cell Ver. Rep. 7, 458-470.
Wu, dY. and Yao, Z. (2005). Isolation and characterization of the murine Nanog gene
promoter. Cell Res. 15, 317-324.
39
Table 1
-Primers sequences used in gene expression analysis
Primers sequence 5’ – 3’
Gene
GenBank accession
Primers Efficiency(%)
number
OCT-4
F: TTCCCCATGGCGGGACACCT
96,09
NM_002701
96,01
NM_024865
R: CCCCTGGCCCATCACCTCCA
NANOG
F: GGTGTGACGCAGAAGGCCTCA
R: AGTCGGGTTCACCAGGCATCC
MDR1
F:
TCCTCAGTCAAGTTCAGAGTCTTCA
102,01
NM_000927
R:
TCTCCACTTGATGATGTCTCTCACT
ALOX-5
F: GTGGCGCGGTGGATTC
94,99
XM_011539564
103,91
NM_003106
103,38
NM_001101
103,14
NM_001402
R: TGGATCTCGCCCAGTTCCT
SOX2
F: AAAAACAGCCCGGACCGCGT
R: CTCCTGGGCCATCTTGCGCC
ΒACTIN
F: CCACCCCACTTCTCTCTAAGGA
R: ACCTCCCCTGTGTGGACTTG
Ef1a
F: GCCAGTGGAACCACGCTGCT
R: ATCCTGGAGAGGCAGGCGCA
OCT-4: POU class 5 homeobox 1 (POU5F1) transcription factor; NANOG: homeoprotein
Nanog transcription factor ; MDR1: ATP-binding cassette, sub-family B (MDR/TAP), member
1 (ABCB1); ALOX-5: arachidonate 5-lipoxygenase (5-LO); SOX-2: Sox-2 transcription factor
βACTIN: Beta Actin; Ef1a: eukaryotic translation elongation factor 1 alpha 1
40
Figures
Fig. 1. Treatment of erythroleukemic cell lines K562 and Lucena with PMA.
Number of viable cells from K562 (A) and Lucena (C) cell lines, and cell viability (%)
of K562 (B) and Lucena (D) cells treated with different concentrations of PMA at
different times of exposure, as determined by trypan blue exclusion. The results are
expressed as means ± S.E.M. *p<0.05 compared to time 0 h.
41
Fig. 2. Analysis of cellular morphology with panoptic dye for hematology of K562
and lucena cell lines. The K562 cells (non-MDR) without treatment (A) and treated
with PMA at 10 nM for 24 h (B). Lucena cells (MDR) without treatment (C) and treated
with PMA at 10 nM for 24 h (D). Arrows indicate megakaryocytic cells. (E) Frequency
of megakaryocytes in both lineages treated with PMA at 1 and 10 nM for 48 and 24 h of
incubation, respectively. Different letters indicate significant differences between the
means of each cell line (p<0.05). * indicates significant differences between the control
groups of both cell lines. (p<0.05).
42
Fig. 3. Relation between PMA and the activity of the ABCB1 efflux pump. (A)
Frequency of megakaryocytes in the Lucena cell line treated during 24 h with PMA at
10 nM and/or 5 µM of Verapamil (VP), the inhibitor of P glycoprotein. (B) Evaluation
of P glycoprotein activity by Rhodamine 123 (Rho) dye extrusion in the Lucena cell
line after treatment with PMA at 10 nM for 24 h. K562 cells did not receive treatment
and was used as a control to show the intracellular fluorescence caused by Rhodamine
123 accumulation. The results are expressed as means ± S.E.M. Different letters
indicate significant differences between means compared to the control group (p<0.05).
(C) Cell viability of the Lucena cell line treated with VP at 5 µM and/or PMA at 10 nM
and/or Vincristine (VCR) at 60 nM using trypan blue immediately at 24 h, 48 h and 72
h after incubation. The results are expressed as means ± S.E.M. Different letters show
significant differences at each treatment (p<0.05).
43
Fig. 4. Relative gene expression of genes in non-MDR and MDR cell lines. Relative
gene expression of Oct-4, Sox-2 and Nanog, P-gp coding gene (Mdr1) and arachidonate
5-lipoxygenase (5-LO) (Alox-5) gene in non-MDR K562 cell line (A) and MDR Lucena
(B) treated with PMA at 10 nM for 24 h. (C) Comparison of Alox-5 and Mdr1 gene
expression in the lineages K562 (non-MDR), Lucena (MDR) and FEPS (MDR).
Different letters indicate significant differences between the means of each gene
(p<0.05).
44
Artigo 2
Influence of Oct4 pseudogene on MDR phenotype of erytroleukemic cells
(Artigo a ser submetido à Journal of Cell Science)
45
Influence of Oct4 pseudogene on MDR phenotype of erytroleukemic cells
Michele Carrett-Dias a,f, Leda Karine Almeidaa, Daniela Volcan Almeidab, Micheli da
Rosa Castrof, Marcelo Alves Vargase,f, Robert Boylea,f, Raphael Silveira Vidal c, Vivian
M. Rumjanekd, Luis Fernando Marins b,f, Ana Paula de Souza Votto a,f*, Gilma Santos
Trindade a,f
a
Laboratório de Cultura Celular, Universidade Federal do Rio Grande - FURG, Rio
Grande, RS, Brazil.
b
Laboratório de Biologia Molecular, FURG, Rio Grande, RS, Brazil.
c
Instituto de Biofísica Carlos Chagas Filho, Centro de Ciências da Saúde, Universidade
Federal do Rio de Janeiro, RJ, Brazil.
d
Laboratório de Imunologia Tumoral, Instituto de Bioquímica Médica, Centro de
Ciências da Saúde, Universidade Federal do Rio de Janeiro, RJ, Brazil.
e
Laboratório de Histologia, FURG, Rio Grande, RS, Brazil.
f
Instituto de Ciências Biológicas, FURG, Rio Grande, RS, Brazil.
* Corresponding author: Votto, A. P. S. Universidade Federal do Rio Grande - FURG,
Instituto de Ciências Biológicas, Av. Itália, Km 8, 96201-900, Rio Grande, RS, Brazil.
E-mail: [email protected]
46
Abstract
The transcription factor Oct4 has been associated with the multidrug resistant
(MDR) phenotype in erythroleukemic cells. This factor has been reported to possess six
pseudogenes. Currently, pseudogenes has received more attention because some of its
proteins have been shown to be functional. Some of these pseudogenes have been found
in cancer cells. In the present study we evaluated the effect of silencing of Oct4 - pg1
pseudogene in gene expression and multidrug resistance phenotype (MDR) in Lucena
cell line. The silencing of Oct4 –pg1 reduced expression of both Mdr1 gene (encoding
the P-glycoprotein (P-gp)) and protein. The expression of Oct4 gene was not affected,
but silencing reduced the expression of its protein. Although, silencing has affected the
expression of P-gp, a Lucena silenced cell line not become sensitive to vincristine. The
results show that the pseudogene can have or a direct effect on the expression of P-gp or
indirect, via oct4.
Keywords: Oct4-pg1, K562, cancer stem cells, P-glycoprotein
47
Introduction
A pseudogene is a gene copy that does not produce a functional, full-length
protein (Vanin, 1985). Pseudogenes originated from reverse transcription of normal
mRNA transcripts are named processed pseudogenes and those resulted from gene
duplication are called nonprocessed pseudogenes (Mighell et al., 2000; Suo et al.,
2005). Some pseudogenes can play regulatory roles over the genes from which they are
originated (Hirotsune et al., 2003; Korneev et al., 1999). Hirotsune et al. (2003) showed
that the pseudogene MAKORINP1 regulate the expression of MAKORIN1 gene throght
its mRNA stability.
Oct4 (official symbol POU5F1, also known as Oct3) is an important member
of Oct protein family, which is well known by its specific POU DNA binding domain
and its diverse functions (Scholer, 1991). The human OCT4 gene encodes three distinct
transcripts trought alternative splicing: Oct4A, Oct4B and Oct4B1. These spliced
variants share the same domains but have distinct N termini. Oct4A (also called Oct4
only) is highly expressed in the nucleus of compacted embryos and blastocyst, and acts
as a main regulator in maintaining the pluripotency and self-renewal capacities of ES
(embryonic stem) and EG (embryonic germ) cells (Guo et al., 2012; Nichols et al.,
1998; Rosner et al., 1990). Moreover, Oct4 is also related to the status of stem cells in
the same way as Sox-2 and Nanog (Chambers and Tomlinson, 2009). Changes in the
expression of these genes may define differentiation, dedifferentiation or self -renewal
of embryogenic stem cells (Chambers et al., 2003; Karwacki-Neisius et al., 2013; Niwa
et al., 2000; Rodda et al., 2005). Oct4 gene has six pseudogenes proposed by
bioinformatics approach namely: Oct4-pg1, Oct4-pg2, Oct4-pg3, Oct4-pg4, Oct4-pg5,
and Oct4-pg6 (Pain et al., 2005). Among the Oct4 pseudogenes, Oct4-pg1, Oct4-pg3
and Oct4-pg4 share a high sequence similarity when compare to Oct4A (Oct4), sharing
the unique N-terminal coding sequence (Redshaw and Strain, 2010). Only adult, noncancer cell type that has been reported to express pseudogenes are cells derived from
peripheral blood (Bhartiya et al., 2012). According Suo and collaborators (2005) an
Oct4 pseudogene localized in human chromosome 10 (named as Oct4-pg5) and a
pseudogene in human chromosome 8 (named as Oct4-pg1) were transcribed in cancers
but not in embryonic carcinoma cells, fibroblast cells, and normal tissues tested.
According to these authors the transcription of Oct4-pg5 and Oct4-pg1 in cancers
48
maybe involved the regulation of the Oct4 gene activity and thus might be pertinent to
carcinogenesis.
It should be considered that activation of certain genes is required for selfrenewal, proliferation and differentiation of the stem cell listed above and cancer stem
cell. Among the various transcription factors associated with pluripotency in stem cells,
Oct4, Nanog and Sox2 are essential for the indefinite division of stem cells without
affect neither the differentiation potential nor their self –renewal capacity (Atari et al.,
2011).
Some studies have associated the expression of Oct4 with the MDR phenotype.
To induce resistant erythroleukemic cell lines, Rumjanek et al. (1994; 2001) and
Daflon-Yunes et al. (2013) established models in vitro using the K562 cell line,
selecting its resistance to chemotherapic drugs as vincristine and daunorubicin. These
erythroleukemic cell lines were named K562-Lucena1 (Lucena) and FEPS, respectively,
being regarded as interesting models for the study of the mechanisms involved in
multidrug resistance (MDR). Marques et al. (2010) reported that Lucena cells showed
higher expression of Oct4 and Mdr1 (Abcb1) genes in comparison to its non-MDR
parental cell line K562. There are several factors that can lead to MDR phenotype, but
the overexpression of Abcb1 (coding for P-glycoprotein, P-gp) (Sonneveld and Wiemer,
1997) is the mechanism best studied. P-gp is expressed on the cell membrane,
responsible
for
efflux
mechanism,
energy-dependent,
capable
of
pumping
chemotherapeutic agents out of the cell (Uchiumi et al., 1993).
This study aimed to knock-down the Oct4–pg1 pseudogene and assessing its
effect on gene expression and MDR phenotype of erythroleukemic Lucena cell line.
49
Results
Basal expression of Oct4, Sox -2 and Nanog gene differs among MDR and non- MDR
cell lines
Basal expression of Oct4, Sox -2 and Nanog can be seen in Fig. 1. The cell
line K562 (non-MDR) had a lower expression of Oct4 and Sox -2 genes compared to
both MDR cell lines (Lucena and FEPS). However, expression of Nanog gene in K562
cells was higher compared with Lucena lineage. The transcription factors gene
expression seem to keep the same level of MDR cell lines expression.
Basal expression of Oct4 protein differs from the constitutive gene expression
Using flow cytometer we verified the presence of Oct4 protein in the cell lines
studied. As shown in Fig. 2, non-MDR strain showed a tag for Oct4 protein similar to
that shown by line FEPS and higher than the other MDR cell line, Lucena. These results
are contrary to those found for the gene expression of Oct4 (Fig. 1).
Silenced Lucena cells in Oct4-pg1 pseudogene decreased the expression of Mdr1 gene.
The silencing of Oct4-pg1 pseudogene reduced expression of the Mdr1 gene
that encoding P-glycoprotein and increased expression of Sox-2 transcription factor
(Fig. 3). The expression of the other genes have not changed with silencing. The
expression of Oct4 gene RT- PCR could be prone to artifacts generated by pseudogene
transcripts; thus, we were careful to design specific primers to amplify the genes of
interest, with resulting sequences from the research in the NCBI site using program
Primer BLAST (Table 1).
The Oct4-pg1 pseudogene silencing reduced the Oct4 protein amount
The POU5F1B-shRNA lineage (silenced) presented an increased of part of the
population (8.64%) unmarked for Oct4 protein when compared to MOCK shRNA cell
line (control) (0.98%) (Fig. 4).
Intracellular marking of Oct4 protein
To confirm the results obtained in flow cytometry (Fig. 2; Fig. 4) and check
the intracellular localization of Oct4 protein in K562, Lucena, Lucena Mock-shRNA
and Lucena POU5F1B-shRNA cell lines was used immunocytochemistry assay. The
50
K562 and Lucena cell lines (Fig. 5) showed nuclear staining with the anti- Oct4
antibody according to the immunocytochemical data. K562 cells seem to have a more
marked "strong" that Lucena cell line, confirming the data obtained by flow cytometry
(Fig. 2). The Lucena Mock-shRNA and POU5F1B-shRNA cell lines had a shown
nuclear staining less intense than K562 cell line. The marking of Lucena Mock-shRNA
strain was similar to found in Lucena, and POU5F1B-shRNA strain did not show
labeling (Fig. 5). This data is in agreement with the results obtained in flow cytometry
(Fig. 4).
Pseudogene Oct4-pg1 can influence the ABCB1 protein expression in Lucena cell line
The ABCB1 expression was assessed using antibody against this molecule to
detect differences in expression levels. As can be seen in Fig. 6, the silencing of OCT4pg1 pseudogene influence the expression of P-gp resistance protein. It observed the
presence of a population unmarked antibody in Lucena POU5F1B lineage-shRNA
(41,76%), greater than the unmarked population found in the lineage Lucena MOCK
shRNA (21,20%).
Silencing of Oct4 - pg1 pseudogene did not alter the sensitivity of Lucena cells to
vincristine
As viewed in Fig. 7, treatment with 60 nM vincristine for 72 h caused no
change in the number of viable cells in the strain Sh-POU5F1B. Vincristine is a known
substrate of the Abcb1 and keeps the MDR feature of Lucena cell line.
Discussion
The Oct4 gene has been extensively studied and most recently, its isoforms and
pseudogenes has aroused the interest and received greater attention within the research
(Miguell et al., 2000; Pain et al., 2005; Redshaw and Strain, 2010; Scholer, 1991). The
study of Oct4 pseudogenes action requires more knowledge to clarify whether a protein
is actually inactive or have actions on other genes. Here we report that there is an
influence of Oct4-pg1 pseudogene on the Oct4 action and a direct action on the Abcb1
expression or an indirect action by Oct4 via.
51
As already reported by Marques et al (2010), MDR Lucena cell line, has a
higher gene expression of Oct4 transcription factor compared to non-MDR parental cell
line, suggesting a relationship between this factor and Mdr1 gene.
In more recent studies, Wu and colleagues (2014) found a positive correlation
between the expression levels of Mdr1 and Oct4 gene in bladder cancer samples. These
authors reported that the overexpression of Oct4 increased the expression of MDR. In
the present study, this correlation was again confirmed for Lucena cell line, and was
further demonstrated for the first time, for the FEPS cell line. As the Oct4, the
transcription factor Sox-2 also had a higher expression in MDR cell lines when
compared to non- MDR. Moreover, Nanog transcription factor had a smaller expression
in Lucena than non-MDR cell line. It was found that the gene expression of
transcription factors Oct4, Nanog and Sox-2 have the same expression profile between
the MDR cell lines. Still, it was shown that the gene responsible for the expression of Pgp (Mdr1) is more expressed in the FEPS than in Lucena line, confirming the data of
Daflon-Yunes and colleagues (2013).
Pseudogenes are generally considered to produce nonfunctional proteins
(Vanin, 1985). However, some studies have shown certain function for some
pseudogenes. Lin and co-authors (2007), suggest that the expression of Oct4
pseudogene can function in mammalian cell line, because in mesenchymal stem cells it
promoted the proliferation and inhibit their differentiation to osteochondral. Hayashi et
al. (2013) also found a role for the Oct4 pseudogene. According to these authors, the
Oct4 pseudogene POU5F1B (Oct4-pg1) when overexpressed in gastric cancer cells
promoted the formation of colonies in vitro as well tumorigenicity and tumor growth in
vivo and when knockdown resulted in an inhibition of colony formation in vitro and in
vivo tumor growth, giving an aggressive phenotype in gastric cancer. In the present
work silencing Oct4-pg1 pseudogene reduced expression of the Mdr1 gene that encodes
P-glycoprotein (Abcb1). The expression of Abcb1 protein also had a decrease in
antibody labeling. However, the expression of the Oct4 gene was not altered by
silencing, although the staining with anti-Oct4 antibody showed a reduction in their
protein expression. The silencing pseudogene POU5F1B performed by Hayashi et al.
(2013) also did not affect the expression of the Oct4 gene in gastric cancer cell.
Even without difference in gene expression of Oct4-pg1 pseudogene, it can be
assumed that there was a population that silenced showed no labeling for OCT4
52
protein.This population considered silenced was not statistically sufficient to reduce
expression of Oct4 gene, but reduced the expression of Oct4 protein. With this result it
was possible to suggest there is some influence of the Oct4-pg1 pseudogene with Oct4
protein expression.
Another finding in this study was that the cells silenced reduced both genes
and protein level expression of Abcb1. We do not know whether this intervention is
direct or via Oct4, once time the Oct4 protein was also reduced.
In the RT-PCR results of the expression of the Oct4 gene is lower in non
MDR cell line, but this strain showed a higher staing for the anti- Oct4 antibody that
MDR Lucena cell line. K562 cells lack a great activity of P-gp and this is observed
when this cell line cannot withdraw from inside the Rhodamine 123. However, from
that same cell line it was possible to give rise to other two, Lucena and FEPS, which
express more Mdr1 and Oct4 than the parental lineage. Thus, we can also consider that
the K562 cell line have a higher amount of proteins related to transcription factors.
Although the results cytometry show a decrease in staing of anti- ABCB1 and
gene expression data also show reduction in the expression of Mdr1 gene, the shPOU5F1B cells did not become sensitive to VCR. The VCR is a known substrate of the
ABCB1 and keeps the MDR phenotype of Lucena cell line. This may be related to the
fact that the Lucena cell line has other resistance mechanisms beyond the
overexpression of P-glycoprotein as a higher antioxidant capacity and higher amount of
tubulin monomers (Votto et al., 2007; 2010), which allows the cytoskeletal
rearrangement, main target of the VCR. In this sense, Daflon-Yunes and collaborators
(2013) observed an increase in sensitivity of Lucena 1 and FEPS when Abcb1 gene was
silenced, however never reaching the levels of the K562 parental cell line, also these
authors suggest that this difference could be due to the fact that other mechanisms are
also responsible for the MDR profile observed.
The nuclear staining of Oct4 transcription factor in the cells studied is
according Cauffman et al. (2006), because according to these authors, the protein Oct4A isoform is found in the nucleus of embryonic stem cells and the antibody used in this
study reacts with this protein. Considering this information we can suggest that cell
lines tested have the isoform of Oct4 responsible for the stem cells characteristic.
Thus the results show a relationship between the Oct4-pg1 pseudogene, the
origin Oct4 gene and the gene encoding P-gp. The silencing this pseudogene caused an
53
Oct4 protein decrease and a protein and also gene of Mdr1 decrease, suggesting that the
Oct4-pg1 pseudogene can have a direct effect on the expression of P-gp or indirectly, by
Oct4 via.
Material and methods
Cell lines and culture conditions
The K562, Lucena and FEPS cell lines were obtained from the Tumoral
Immunology Laboratory at the Medical Biochemistry Institute of the Federal University
of Rio de Janeiro (Brazil). The cells were grown at 37ºC in 5% CO2 humidified
environment in disposable plastic flasks containing RPMI1640 (Gibco) medium
supplemented with sodium bicarbonate (0.2 g/L) (Vetec), L-glutamine (0.3 g/L)
(Vetec), Hepes (25mM) (Acros), fetal bovine serum (FBS-10%; Gibco), 1% antibiotic
(penicillin –100 U/mL) and streptomycin (100 g/mL) (Gibco) and antimicotic
(amphotericin-B 0.25 mg/mL – Sigma). Lucena and FEPS were maintained with 60 nM
of vincristine (VCR) (Sigma) and 300 nM of daunorubicin (DNR) (Sigma),
respectively.
Plasmid
The POU5F1B SureSilencing shRNA Plasmid (Qiagen, cat. no. KH66786)
contains neomycin resistance gene was used. The plasmids were first transformed into
competent E.coli cells (Top10 strains), selected with ampicillin, and purified with the
Plasmid Maxi-Prep Kit (Qiagen). Plasmid preparations were quantified by fluorometry
in a QubitTM fluorometer, using Quanti-iTTM dsDNA Br Assay Kit (Invitrogen). It was
used at PstI restriction enzyme (Invitrogen) to confirm the presence of the gene of
interest cloned in plasmid. The result was confirmed by electrophoresis in 1.5% agarose
gel with ethidium bromide (0.5µg/mL).
POU5F1B silencing
Lucena cells were silenced for the POU5F1B gene expression by transfection
with shRNA plasmids provided in the Qiagen SureSilencing kit (QIAGEN, Dusseldorf,
Germany). The POU5F1B shRNA plasmid used was the KH66786. Briefly, 1 x 106
cells were transfected with 2 µg of the POU5F1B -shRNA and mock plasmids using the
Amaxa Cell Line Nucelofector Kit V (Lonza, Basel, Switzerland) on an Amaxa
54
Nucleofector II device set on program T-016. Immediately after transfection, cells were
incubated in a well of a 12-well microplate at 37 ºC and 5 % CO2. After 24 h, 1 mg/mL
of G418 (Sigma Chemical Co., St. Louis, USA) was added for selection of successfully
transfected cells. After two weeks, G418 concentration was kept at 0.5 mg/mL in cell
culture.
Analysis of protein expression by flow cytometry
1x105 cells were fixed with 1 mL BioLegend´s Nuclear Factor Fixation Buffer
(BioLegend, San Diego, USA), at room temperature in the dark for 20 minutes. It was
washed once with 1 mL BioLegend´s Nuclear Factor Permeabilization Buffer (1x),
resuspended with 1 ml BioLegend´s Nuclear Factor Permeabilization Buffer (1x) and
kept for 20 min at room temperature in the dark. After incubation, the flurochromeconjugated antibody Alexa Fluor® 488 anti-Oct4 (Oct3) mouse IgG2b, κ Clone
3A2A20 (BioLegend) was added and cells were incubated at room temperature in the
dark for 30 minutes. For ABCB1 detection, 1x105 cells were washed with PBS plus 5 %
FCS and incubated with FITC mouse anti-human ABCB1 clone 17F9 (Becton,
Dickinson and Company, Franklin Lakes, USA) at room temperature in the dark for 30
minutes. After 30 minutes in both protocol, cells were washed in PBS plus 5 % FCS,
and immediately analyzed by flow cytometer. Ten thousand cells were examined under
each condition using a FACSCalibur flow cytometer (Becton, Dickinson and Company,
Franklin Lakes, USA) and all flow cytometry analysis were accomplished using the
Summit software v4.3 (DAKO, Glostrup, Denmark).
Sensitivity cell line silenced the VCR
Lucena silenced and mock cells were centrifuged, washed twice with PBS
(Ca+2–Mg+2-free), suspended in RPMI 1640 medium and maintained in 96-well culture
plates (to 5×105 cells/mL). To evaluate the sensitivity, the cells were treated with 60 nM
of the chemotherapeutic VCR.
Cell viability assay
Cell viability was determined by trypan blue exclusion immediately (0 h), 24,
48 and 72 h after incubation of Lucena silenced cells with VCR.
55
Immunocytochemistry assay
The slides were prepared by centrifugation of the cultured cells in a cytospin
centrifuge (MPW-351R, MPW Med. Instruments). K562 and Lucena cell lines were
fixed in Permeabilization Buffer 4% paraformaldehyde and permeabilized with
BioLegend Nuclear Factor Fixation. After, the slides were incubated with 5% bovine
serum albumin (BSA) for 30 minutes to block nonspecific antigens. The next step was
the application of the polyclonal anti-human OCT4 (clone 3A2A20) Alexa Fluor® 488
(BioLegend) (1:500 dilution) on the sections, in dark for 3 days at 4◦C. Finally, 4´-6diamidino-2-phenylindole (DAPI) (Sigma-Aldrich) (1:10000 dilution) was used to
reveal the cell nuclei. A negative control was performed with the same protocol, but
without the addition of the anti-human OCT4. Coverslips were mounted using
Fluoromount® (Sigma-Aldrich). Slides were observed using confocal microscope.
Gene expression
Total RNA was extracted from six samples of each cell line with an amount of
2×106 per sample cells according to the protocol of the manufacturer of TRIzol Reagent
(Invitrogen, Brazil). The RNAs were quantified by fluorometry in a QubitTM
fluorometer, using Quanti-iTTM RNA Assay Kit (Invitrogen, Brazil). The RNA integrity
was confirmed by electrophoresis in 1.5% agarose gel with ethidium bromide
(0.5µg/mL). cDNA synthesis was performed by reverse transcription of 2 µg RNA
using the High Capacity cDNA Reverse Transcriptase kit (Applied Biosystems, Brazil).
The gene expression analysis was performed by real-time quantitative PCR (qPCR).
Gene-specific primers (Table 1) were designed based on sequences available in
GenBank using the Primer Blast tool (http://www.ncbi.nlm.nih.gov). Previously, the
PCR amplification efficiency of each primers pair was evaluated by serial dilutions
reactions where the efficiency of reactions showed appropriate parameters (Table 1).
EF1a and βactin were choosen as reference genes after presented stability when tested
with geNorm applet (Vandesompele et al. 2002). For gene expression, each sample was
analyzed in triplicate on ABI 7500 platform Real Time Systems (Applied Biosystems,
Brazil) using the detection system Platinum SYBR Green qPCR SuperMix (Invitrogen,
Brazil). Normalization factor was calculated as the geometric mean of the expression
values of the reference genes tested by geNorm applet. Relative expression levels of the
56
target genes are calculated by dividing the expression value of the target gene by the
normalization factor.
Statistical analysis
Analysis of variance (ANOVA), followed by Tukey’s post hoc test, was
applied to cell viability analysis. For analysis of gene expression t test was used. The
data normality and variance homogeneity were previously tested. The results are
expressed as mean±S.E.M. Each experiment was performed three times using triplicates
in each experiment significance level was fixed at p<0.05.
Competing interests
The authors declare no competing or financial interests.
Author contributions
M.C.D. maintained the cell lines, preparation of plasmid, performed transfection with
plasmid, prepared the RNA samples, ran quantitative real-time PCR, executed the cell
line assays, performed imunocytochemistry assay, analyzed data, wrote the manuscript
and prepared figures; L.K.A. maintained the cell lines; D.V.A. prepared the RNA
samples, ran quantitative real-time PCR, analyzed data, contributed to the manuscript
writing and prepared tables; M.R.C. performed imunocytochemistry assay and assisted
in microscopy; M.A.V. performed imunocytochemistry assay and analysed on
microscope slides; R.B. analysed imunocytochemistry blades in the microscope; R.S.V.
performed transfection with plasmid, analyzed the protein expression in the cytometer
flow; V.M.R. reviewed and discussed the results of flow cytometry; L.F.M. contributed
by providing real-time PCR reagents, analyzing data and helping with the manuscript
writing; A.P.S.V. analyzed data and contributed to the manuscript writing; and G.S.T.
analyzed data and contributed to the manuscript writing.
Funding
This work was supported by the Brazilian agencies: CNPq (Conselho Nacional de
Desenvolvimento Científico e Tecnológico) and CAPES (Coordenação de
Aperfeiçoamento de Pessoal de Nível Superior).
57
References
Asadi, M. H., Mowla, S. J., Fathi, F., Aleyasin, A., Asadzadeh, J. and Atlasi, Y.
(2011). OCT4B1, a novel spliced variant of OCT4, is highly expressed in gastric cancer
and acts as an antiapoptotic fator. Int. J. Cancer 128, 2645–2652.
Atari, M., Barajas, M., Hernández-Alfaro, F., Gil, C., Fabregat, M., Padró, E.F.,
Giner, L. and Casals, N. (2011). Isolation of pluripotent stem cells from human third
molar dental pulp. Histol. Histopathol. 26, 1057-1070.
Bhartiya, D., Shaikh, A., Nagvenkar, P., Kasiviswanathan., S., Pethe, P., Pawani,
H., Mohanty, S., Rao, S. G. A., Zaveri, K. and Hinduja, I. (2011). Very small
embryonic- like stem cells with maximum regenerative potential get discarded during
cord blood banking and bone marrow processing for autologous stem cell therapy. Stem
Cells Dev.21, 1-10.
Cauffman, G., Liebaers, I., Steirteghem, A. V. and De Velde, H. V. (2006).
POU5F1 isoforms show different expression patterns in human embryonic stem cells
and preimplantation embryos. Stem Cells 24, 2685–2691.
Chambers, I. and Tomlinson, S. R. (2009). The transcriptional foundation of
pluripotency. Development 136, 2311-2322.
Chambers, L., Colby, D., Robertsom, M., Nichols, J., Lee, S., Tweedie, S. and
Smith, A. (2003). Functional expression cloning of nanog, a pluripotency sustaining
factor in embryonic stem cells. Cell 113, 643-655.
Daflon-Yunes, N., Pinto-Silva, F. E., Vidal, R. S., Novis, B. F., Berguetti, T., Lopes,
R. R. S., Polycarpo, C. and Rumjanek, V. M. (2013). Characterization of a multidrugresistant chronic myeloid leukemia cell line presenting multiple resistance mechanisms.
Mol. Cell Biochem. 383, 123–135.
Hayashi, H., Arao, T., Togashi, Y. , Kato, H., Fujita, Y., Velasco, M. D., Kimura,
H., Matsumoto, K., Tanaka, K., Okamoto, I. et al. (2013). The OCT4 pseudogene
POU5F1B is amplified and promotes an aggressive phenotype in gastric câncer.
Oncogene 1–10.
Hirotsune, S., Yoshida, N., Chen, A., Garrett, L., Sugiyama, F., Takahashi, S.,
Yagami, K., Wynshaw-Boris, A. and Yoshiki, A. (2003). An expressed pseudogene
regulates the messenger-RNA stability of its homologous coding gene. Nature 423, 91–
96.
58
Jez, M., Ambady, S., Kashpur, O., Grella, A., Malcuit, C., Vilner, L., Rozman, P.,
Dominko, T. (2014) Expression and differentiation between OCT4A and its
pseudogenes in human ESCs and differentiated adult somatic cells. PLoS ONE 9,
e89546.
Kandouz, M., Bier, A., Carystinos, G. D., Alaoui-Jamali, M. A., Batist, G. (2004).
Connexin43 pseudogene is expressed in tumor cells and inhibits growth. Oncogene 10,
4763-4770.
Karwacki-Neisius, V., Göke, J., Osorno, R., Halbritter, F., Ng, J. H., Weiße, A. Y.,
Wong, F. C. K., Gagliardi, A., Mullin, N. P., Festuccia, N., et al. (2013). Reduced
Oct4 expression directs a robust pluripotent sState with distinct signaling activity and
increased enhancer occupancy by Oct4 and Nanog. Cell Stem Cell 12, 531–545.
Korneev, S. A., Park, J. H. and O’Shea, M. (1999). Neuronal expression of neural
nitric oxide synthase (nNOS) protein is suppressed by an antisense RNA transcribed
from an NOS pseudogene. J. Neurosci. 19, 7711–7720.
Lin, H., Shabbir, A., Molnar, M. and Lee, T. (2007). Stem cell regulatory function
mediated by expression of a novel mouse Oct4 pseudogene. Biochem. Bioph. Res.
Commun. 355, 111–116.
Marques, D. S., Sandrini, J. Z., Boyle, R. T., Marins, L. F. and Trindade, G. S.
(2010). Relationships between multidrug resistance (MDR) and stem cell markers in
human chronic myeloid leukemia cell lines. Leukemia Res. 34, 757–762.
Mighell, A. J., Smith, N. R., Robinson, P. A. and Markham, A. F. (2000). Vertebrate
pseudogenes. FEBS Lett. 468, 109–114.
Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D.,
Chambers, I., Schöler., H. and Smith, A. (1998). Formation of pluripotent stem cells
in the mammalian embryo depends on the POU transcription factor Oct4. Cell 95, 379–
391.
Niwa, H., Miyazaki, J. and Smith, A.G. (2000). Quantitative expression of Oct-3/4
defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24,
372-376.
Okamoto, K., Okazawa, H., Okuda, A., Sakai, M., Muramatsu, M. and Hamada,
H. (1990). A novel octamer binding transcription factor is differentially expressed in
mouse embryonic cells. Cell 60, 461–472.
59
Pain, D., Chirn, G-W., Strassel, C. and Kemp, D. M. (2005). Multiple
retropseudogenes from pluripotent cell-specific gene expression indicates a potential
signature for novel gene identification. J. Biol. Chem. 280, 6265–6268.
Pesce, M., Wang, X., Wolgemuth, D. J. and Scholer, H. (1998). Differential
expression of the Oct-4 transcription factor during mouse germ cell differentiation.
Mech. Dev. 71, 89–98.
Redshaw, Z. and Strain, A. J. (2010). Human haematopoietic stem cells express Oct4
pseudogenes and lack the ability to initiate Oct4 promoter-driven gene expression. J.
Negat. Results. Biomed. 9: 2.
Rodda, D. J., Chew, J. L., Lim, L. H., Loh, Y. H., Wang, B., Ng, H. H. and
Robson, Paul. (2005). Transcriptional Regulation of Nanog by OCT4 and SOX2. J.
Biol Chem. 280, 24731–24737.
Rosner, M. H., Vigano, M. A., Ozato, K., Timmons, P. M., Poirier, F., Rigby, P.W.
and Staudt, L.M. (1990). A POU-domain transcription factor in early stem cells and
germ cells of the mammalian embryo. Nature 345, 686–692.
Rumjanek, V. M., Lucena, M., Campos, M. M., Marques-Silva, V. M. and Maia, R.
C. (1994). Multidrug resistance in leukemias: the problem and some approaches to its
circumvention. Ciência e Cultura J. Braz. Assoc. Adv. Sci. 46, 63–69.
Rumjanek, V. M., Trindade, G. S., Wagner-Souza, K., Meletti-de-Oliveira, M. C.,
Marques-Santos, L. F., Maia, R. C. and Capella, M. A. M. (2001). Multidrugresistance in tumor cells: characterization of the multidrug resistant cell line K562Lucena 1. Ann. Acad. Bras. Cienc. 73, 57–69.
Scholer, H. R. (1991). Octamania: the POU factors in murine development. Trends
Genet. 7, 323–329.
Sonneveld, P. and Wiemer, E. (1997). Assays for the analysis of P-glycoprotein in
acute myeloid leukemia and CD34 subsets of AML blasts. Leukemia 11, 1160-1165.
Suo, G., Han, J., Wang, X., Zhang, J., Zhao, Y., Zhao, Y. and Dai, J. (2005). Oct4
pseudogenes are transcribed in cancers. Biochem. Bioph. Res. Commun. 337, 1047–
1051.
Takeda, J., Seino, S. and Bell, G. l. (1992). Human Oct3 gene family: cDNA
sequences, alternative splicing, gene organization, chromosomal location, and
expression at low levels in adult tissues. Nucleic Acids Res. 20, 4613–4620.
60
Uchiumi, T., Kohno, K., Tanimura, H., Matsu, K., Sato, S., Uchida, Y. and
Kuwano, M. (1993). Enhanced expression of the human multidrug resistance 1 gene in
response to UV light irradiation. Cell Growth Differ. 4, 147-157.
Vanin, E. F. (1985). Processed pseudogenes: chacacteristics and evolution. Ann. Rev.
Genet. 19, 253-272.
Votto, A. P. S., Renon, V. P., Yunes, J. S., Rumjanek, V. M., Capella, M. A. M.,
Moura- Neto, V., Freitas, M. S., Geracitano, L. A., Monserrat, J. M. and Trindade,
G. S. (2007). Sensitivity to microcystins: A comparative study in human cell lines with
and without multidrug resistance phenotype. Cell Biol. Int. 31, 1359-1366.
Votto, A. P. S., Domingues, B. S., Souza, M. M., Silva Júnior, F. M. R., Caldas, S.
S., Filgueira, D. M. V. B., Clementin, R. M., Primel, E. G., Vallochi, A. L., Furlong,
E. B., et al. (2010). Toxicity mechanisms of onion (Allium cepa) extracts and
compounds in multidrug resistant erythroleukemic cell line. Biol. Res. 43, 429-437.
Xiao-Jie, L., Ai-Mei, G., Li-Juan, J. and Jiang, X. (2015). Pseudogene in cancer: real
functions and promising signature. Med. Gene.t.52,17–24.
Xin, H., Kong, Y., Jiang, X., Wang, K., Qin, X., Miao, Z-H., Zhu, Y. and Tan, W.
(2013). Multi-Drug–Resistant cells enriched from chronic myeloid leukemia cells by
doxorubicin possess tumor-initiating–cell properties. J. Pharmacol. Sci. 122, 299 – 304.
Wang, X. Q., Ongkeko, W. M., Chen, L., Yang, Z. F., Lu, P., Chen, K. K., Lopez,J.
P., Poon, R. T. P. and Fan, S. T. (2010). Octamer 4 (Oct4) mediates chemotherapeutic
drug resistance in liver cancer cells through a potential Oct4–AKT–ATP-Binding
Cassette G2 pathway. Hepatology 52, 528-539.
Wu, C. L., Lu, C. S. and Shiau, A. L. (2014). Multidrug resistance gene MDR1 is
transactivated by Oct4 to increase chemotherapy resistance. Eur. J. Cancer 50, S63.
Zhao, Q., Ren, H., Feng, S., Chi, Y., He, Y., Yang, D., Ma, F., Li, J., Lu, S., Chen,
F. et al. (2015). Aberrant expression and significance of OCT-4A transcription factor in
leukemia cells. Bood Cell Mol. Dis. 54, 90–96.
Zou, G-M. (2007). Cancer stem cells in Leukemia, recent advances. J. Cell. Physiol.
213, 440-444.
61
Table 1
Primers sequences used in gene expression analysis
Gene
Primers sequence 5’ – 3’
Primers
Efficiency(%)
GenBank
accession
number
Oct4
F:TTCCCCATGGCGGGACACCT
96,09
NM_002701
96,01
NM_024865
102,01
NM_000927
99,77
NM_001159542
103,91
NM_003106
103,38
NM_001101
103,14
NM_001402
R: CCCCTGGCCCATCACCTCCA
Nanog
F:GGTGTGACGCAGAAGGCCTCA
R:AGTCGGGTTCACCAGGCATCC
Mdr1
F:TCCTCAGTCAAGTTCAGAGTCTTCA
R:TCTCCACTTGATGATGTCTCTCACT
Oct4-pg1
F: ATGCTTCAGGCACTGTGTTC
R: TGTGACCGTATGGCTGTGTG
Sox2
F:AAAAACAGCCCGGACCGCGT
R:CTCCTGGGCCATCTTGCGCC
Βactin
F:CCACCCCACTTCTCTCTAAGGA
R:ACCTCCCCTGTGTGGACTTG
Ef1a
F:GCCAGTGGAACCACGCTGCT
R:ATCCTGGAGAGGCAGGCGCA
Oct4: POU class 5 homeobox 1 (POU5F1) transcription factor;
Nanog:homeoproteinNanog transcription factor ;Mdr1: TP-binding cassette, sub-family
B (MDR/TAP), member 1 (ABCB1); Oct4-pg1: pseudogene POU class 5 homeobox 1B
(POU5F1B): ; Sox-2: Sox-2 transcription factor βactin: Beta Actin; Ef1a: eukaryotic
translation elongation factor 1 alpha 1
62
Figures
Fig. 1. Relative gene expression of Oct4, Sox -2 and Nanog in non-MDR and MDR
cell lines. Comparison of basal expression between lines not MDR K562 and MDR
Lucena and FEPS. Different letters show significant differences between means of each
Relative gene expression
gene (p<0.05).
2.5
K562
Lucena
FEPS
b
2.0
b
b
1.5
b
a
a,b
1.0
a
0.5
b
a
0.0
OCT4
SOX-2
NANOG
63
Fig. 2. Constitutive expression of Oct4 protein. Representative histogram of K562
(black line with transparent background), Lucena (Gray) and FEPS (Black) labeled with
anti-Oct4 antibody. Histograms represent the profile of fluorescence.
64
Fig. 3. Relative gene expression of diversos genes of Lucena cell line after
POU5F1B silencing. Comparison of expression between the control (mock shRNA) e
silencing cells (POU5F1B shRNA). Different letters show significant differences
between means of each gene (p<0.05).
65
Fig. 4. Expression of Oct4 on silenced cell line. Representative histogram of Lucena
cells (transfected with shRNA or shPOU5F1B) labeled with anti-Oct4 antibody. The
empty histograms represents the profile of cells transfected with shRNA (mock
controls) in the presence of Oct4 antibody and the striped histograms represent the
profile of cells transfected with shPOU5F1B (silenced cells) in the presence of Oct4
antibody.
66
Fig. 5. Immunocytochemistry of OCT4 in eritroleukemic cells. Cells were stained
with OCT4 antibody, as indicated. Green–OCT4.
67
Fig. 6. Expression of ABCB1 on silenced cell line. Representative histogram of
Lucena cells (transfected with shRNA or shPOU5F1B) labeled with ABCB1 antibody.
The empty histograms represents the profile of cells transfected with shRNA (mock
controls) in the presence of ABCB1 antibody and the striped histograms represent the
profile of cells transfected with shPOU5F1B (silenced cells) in the presence of ABCB1
antibody.
68
Fig. 7. Sensitivity of cells silenced for vincristine. Number of viable cells of control
(mock shRNA) and silencing (POU5F1B shRNA) cells treated with 60 nM of VCR at
different times of exposure by Trypan Blue exclusion test. Results are expressed as
means ± S.E.M. Equal letters do not show significant difference of means of between
cell lines (p<0.05).
69
Discussão Geral
A plasticidade celular é garantia de inesgotável fonte de pesquisa. Quando
pensamos na capacidade de defesa das células frente a diferentes formas de agressão ao
ambiente celular, responsável por sua sobrevida e sobrevida do organismo; quando
refletimos na presença de células tronco em diferentes fases de maturação, responsáveis
pela manutenção e renovação de diferentes linhagens, tecidos, órgãos e sistemas,
estamos refletindo sobre a capacidade plástica das células e suas consequentes relações
gênicas e proteicas que a justificam. Ainda considerando a plasticidade celular e suas
relações, porém agora levando em conta células patológicas, como as tumorais, a
abrangência investigativa é, consideravelmente, maior. O presente trabalho analisou
alguns aspectos da plasticidade celular em diferentes linhagens leucêmicas. No primeiro
artigo foi avaliada uma possível relação entre a diferenciação celular e o fenótipo de
resistência a múltiplas drogas (MDR) em células eritroleucêmicas. Sem dúvida, o
fenótipo MDR é uma das principais causas de insucesso no tratamento do câncer, e
dentro do quadro da busca incessante para o tratamento desta desordem celular,
promover a diferenciação tem sido encarado como uma alternativa terapêutica (Melo e
Barnes, 2007).
Baseado nas publicações que ressaltam que o tratamento com Phorbol-12miristato-13 acetato (PMA) induz a diferenciação megacariocítica na linhagem K562
(Herrera et al., 1998; Hirose et al., 2013; Huo et al., 2006; Murray et al., 1993), este
composto foi utilizado no presente estudo. Estes autores utilizaram concentrações
variadas de PMA, o que exigiu a construção de uma curva dose/resposta no presente
trabalho.
Na linhagem não-MDR K562, houve citotoxicidade a partir de 10 nM de PMA,
enquanto para a linhagem Lucena esta concentração apenas inibiu a proliferação celular.
Já Chen e colaboradores (2011) notaram inibição de proliferação em células K562
tratadas com 80 nM de PMA e relacionaram esta inibição com o aumento de apoptose.
Outros autores demonstraram que o tratamento dessas mesmas células com PMA
resultou em parada no crescimento celular, poliploidia, mudanças morfológicas e
aumento na adesão célula a célula e célula a substrato (Butler et al., 1990; Colamonici
et al., 1985; Fukuda 1981; Hocevar et al., 1992; Long et al., 1990; Tetteroo et al.,
1984).
70
No presente estudo a concentração de 10 nM de PMA foi capaz de induzir a
diferenciação das células K562 para megacariócitos, o que corrobora com os resultados
de outros autores (Chen et al. 2011; Herrera et al., 1998). Entretanto, para a linhagem
MDR Lucena, esta diferenciação para megacariócitos não foi observada, o que permitiu
considerar alguns fatores.
De acordo com Hirose et al. (2013) a acumulação intracelular de espécies
reativas de oxigênio está envolvida na diferenciação megacariocítica induzida por PMA
em células de leucemia K562. Neste sentido, Trindade et al. (1999) e Votto et al.,
(2007; 2010) demonstraram que as células Lucena possuem mais atividade de enzimas
antioxidantes do que a linhagem K562, sugerindo uma menor acumulação intracelular
de espécies reativas de oxigênio na linhagem MDR, o que por sua vez poderia estar
inibindo a indução de diferenciação para este tipo celular.
Outro fator que poderia explicar este resultado pode estar relacionado à grande
atividade da bomba de efluxo encontrada na linhagem MDR, a qual poderia estar
expulsando o PMA destas células. Importante lembrar que as células Lucena possuem
uma expressão do gene MDR1, que codifica a gp-P, em torno de 1400 vezes maior que
na linhagem parental K562 (Marques et al., 2010).
De fato, pudemos constatar neste estudo que a gp-P não foi inibida pelo
tratamento com PMA uma vez que sua utilização não foi capaz de aumentar a
fluorescência das células que receberam Rhodamine 123.
Para certificarmos que a Lucena realmente não apresenta comportamento
semelhante a linhagem K562 quanto à diferenciação, bloqueamos a gp-P com verapamil
e esse bloqueio não reverteu em aumento significativo de megacariócitos na linhagem
Lucena tratada com PMA.
Uma possibilidade é que o PMA não induza diferenciação para megacariócitos
na linhagem Lucena, podendo induzir sua diferenciação para outro tipo celular, como
eritrócitos, por exemplo. De fato, dentro do desenvolvimento de diferenciação normal
dos mieloblastos (lembrando que é este o tipo de célula das linhagens em estudo), o
progenitor desta linhagem é comum para as linhagens eritróide e megacariocítica. Este
tipo de célula progenitora foi identificado nas linhagens K562 e Lucena, uma vez que
ambas
apresentaram
marcadores
de
célula-tronco
hematopoiética
(fenótipo
CD34+CD38-) (Marques et al., 2010).
71
Buscando possíveis relações gênicas nos processos de diferenciação foi possível
confirmar a presença de populações de células tronco nas linhagens K562 e Lucena,
levando em conta a expressão dos fatores de transcrição Oct-4, Sox-2 e Nanog. Na
análise, foi observada a expressão reduzida dos genes Nanog e Alox-5 na linhagem
K562 tratada com PMA, o que pode estar relacionado com a diferenciação celular
observada, uma vez que Nanog é diminuído durante a diferenciação de célula-tronco
embriogênica (Chambers et al., 2003), e segundo Wu and Yao (2005) não há relatos
sobre a expressão de Nanog em células diferenciadas.
Já na linhagem Lucena também foi observada uma redução na expressão do
gene Alox-5, podendo sugerir algum processo de diferenciação induzido pela incubação
com PMA, mas que, conforme já discutido acima, provavelmente não siga o caminho
da diferenciação megacariocítica. Também a linhagem FEPS recebeu tratamento com
10 nM de PMA (dados não mostrados e não submetidos à publicação) e a expressão
gênica também foi verificada. Com relação a expressão do gene Alox-5, após o
tratamento, não houve expressão desse gene. Este fato pode ser explicado em função da
expressão basal desse gene já ser muito baixa. Também nessa linhagem a expressão do
gene Oct4 foi reduzida e do gene Nanog não teve diferença após tratamento. Seguindo a
linha de análise, pode ser sugerido que a linhagem FEPS também diferenciou.
Wang e colaboradores (2011), estudando o composto sintético Nordy,
observaram uma inibição da enzima Alox-5 e uma atenuação no crescimento de células
tronco de gliomas (GSLCs). Além disso, Nordy inibiu também a auto-renovação e
induziu a diferenciação de GSLCs, in vitro e in vivo. Ainda neste trabalho, os autores
observaram uma redução na expressão dos fatores de transcrição associados com o
estado de célula-tronco Nanog, Oct-4 e Sox-2, sugerindo que a transcrição desses genes
foi atenuada no processo de diferenciação astrocítica.
No presente estudo, a não alteração de determinados genes após tratamento com
PMA, pode estar relacionada com as diferentes mutações identificadas nas linhagens
K562 e Lucena para o gene Oct4 (Oliveira et al., 2015).
Quanto ao gene Alox-5, Chen et al. (2009) tem relacionado esse gene com a
diferenciação celular. De acordo com os autores, o gene Alox-5 parece ser um alvo bem
determinante para atenuar os malefícios da LMC. Os autores demonstraram que esse
gene parece ter papel importante na regulação funcional da célula-tronco leucêmica
(LSCs). No estudo, a deficiência do gene Alox-5 em camundongos causou
72
comprometimento da função de LSCs, mas não em células tronco hematopoiéticas
normais. Progressos recentes na biologia do câncer indicam que a erradicação de células
tronco tumorais é essencial para uma terapia mais efetiva. Assim, a inibição deste gene
está associada à diferenciação celular, devolvendo às células tumorais uma propriedade
não tumoral.
Constatando que as expressões gênicas da linhagem parental K562 e das células
MDR Lucena podem apresentar diferentes perfis, foi realizado um estudo comparativo
sobre a expressão dos genes Alox-5 e Mdr1 nessas linhagens, acrescido das expressões
destes genes também na linhagem MDR FEPS. Interessantemente, os resultados
indicaram um perfil de expressão invertido para os genes Alox-5 e Mdr1 nas linhagens
estudadas. O gene Mdr1 foi mais expresso nas células Lucena e FEPS e o Alox-5 menos
expresso nessas linhagens quando comparado com a expressão desses genes nas células
K562. Estes dados estão de acordo Moreira e colaboradores (2014). Segundo os dados
de Microarray apresentados pelos autores, quando comparadas as expressões do gene
Mdr1 entre K562 e Lucena, a segunda linhagem apresentou 287.62 vezes
superexpresso. Quando comparadas as expressões do mesmo gene entre K562 e FEPS,
a segunda linhagem apresentou 1759.56 vezes superexpresso que a linhagem parental.
Quando comparada a expressão do gene Alox-5 entre as linhagens K562 e FEPS, a
linhagem resistente apresentou 454.14 vezes menos expresso. Além disso, quando
tratamos a linhagem K562 com PMA, para induzir a diferenciação, essa relação se
inverteu. O tratamento aumentou a expressão do gene MDR1 e diminuiu a expressão do
gene Alox-5. Assim a diminuição do gene Alox-5 parece realmente estar associada com
a diferenciação nestas células.
Ainda neste sentido, cabe considerar que a linhagem Lucena, com menor
expressão de Alox-5, apresentou maior número de megacariócitos sem tratamento com
PMA quando comparado com a presença dessas células com as mesmas condições na
linhagem K562. Assim, é possível perceber que a linhagem MDR, com a presença de
um maior número de células tronco (Marques et al., 2010) possui maior potencial de
diferenciação.
Como já relatado por Marques et al. (2010), a linhagem MDR Lucena,
apresenta uma maior expressão gênica do fator de transcrição Oct4 quando comparada
com a linhagem parental não-MDR, sugerindo uma relação entre esse fator e o gene
Mdr1. Em estudos mais recentes, Wu et al. (2014) encontraram uma correlação positiva
73
entre os níveis de expressão do gene Oct4 e o Mdr1 em amostras de câncer de bexiga.
Naquele trabalho, os autores relataram que a superexpressão de Oct4 aumentou a
expressão de Mdr1. No presente trabalho, esta correlação foi novamente confirmada
para a linhagem Lucena, e ainda foi demonstrada, pela primeira vez, para a linhagem
FEPS.
Este trabalho também demonstrou que, assim como o Oct4, o fator de
transcrição chamado Sox-2 teve uma maior expressão nas linhagens MDR quando
comparada com a não-MDR. Por outro lado, o fator de transcrição Nanog teve uma
expressão menor na linhagem Lucena do que na linhagem não-MDR. Xin e
colaboradores (2013) encontraram resultados semelhantes quanto à expressão dos
fatores de transcrição Oct4 e Sox2 nas linhagens K562 (sensível) e K562/A02
(resistente). No presente trabalho a expressão do fator de transcrição Nanog foi maior na
linhagem K562, diferente do que foi encontrado por Xin et al. (2013).
Foi possível constatar que a expressão gênica dos fatores de transcrição Oct4,
Sox-2 e Nanog apresentam o mesmo perfil de expressão entre as linhagens MDR.
Ainda, foi demonstrado que o gene responsável pela expressão da gp-P, (Mdr1) é mais
expresso na linhagem FEPS do que na linhagem Lucena, corroborando com os dados de
Daflon-Yunes, et al. (2013).
Como já mencionado acima, o gene Oct4 é um dos principais genes relacionados
aos processos de diferenciação e de aquisição do fenótipo MDR. Desta forma, o gene
Oct4 é amplamente estudado e suas isoformas e pseudogenes tem despertado interesse
nas pesquisas (Miguell et al., 2000; Pain et al., 2005; Redshaw and Strain, 2010;
Scholer, 1991). O estudo da ação dos pseudogenes, aqui em especial do gene Oct4,
requer mais conhecimento para esclarecer se o produto de sua transcrição é realmente
inativo ou se tem alguma ação sobre outros genes. Com este objetivo foi produzido o
segundo artigo deste estudo.
Os pseudogenes são geralmente sequências de DNA que produzem proteínas
não funcionais (Vanin, 1985). Entretanto, alguns trabalhos tem demonstrado certa
função para alguns pseudogenes.
Lin et al. (2007), sugerem que a expressão de um pseudogene Oct4 pode ser
funcional em células de linhagem de mamífero, pois em célula-tronco mesenquimal a
sua expressão promoveu a proliferação e inibiu sua diferenciação osteocondral.
Também Hayashi e colaboradores (2013) encontraram uma função para o pseudogene
74
Oct4. De acordo com esses autores, o Oct4 pseudogene POU5F1B (Oct4-pg1) confere
um fenótipo agressivo no câncer gástrico, pois quando superexpresso foi capaz de
promover a formação de colônias in vitro, bem como a formação do tumor e o
crescimento do tumor in vivo; por outro lado, seu silenciamento, resultou em uma
inibição da formação da colônia in vitro e do crescimento do tumor in vivo.
No presente trabalho o silenciamento do pseudogene Oct4-pg1, nas células
Lucena, reduziu a expressão do gene Mdr1 que codifica a glicoproteína-P (Abcb1). Esta
redução gênica também foi acompanhada de uma diminuição na expressão da proteína
Abcb1 na marcação com anticorpo. Não sabemos se essa intervenção é direta ou via
Oct4, pois a proteína Oct4 também foi reduzida.
Considerando-se o fator de transcrição Oct4, a nível gênico, a expressão do gene
Oct4 não foi alterada com o silenciamento, embora a marcação com anticorpo anti-Oct4
tenha mostrado uma redução na sua expressão protéica. A não alteração na expressão
gênica corrobora com os resultados obtidos por Hayashi et al. (2013), quando aqueles
autores promoveram o silenciamento do pseudogene POU5F1B sem afetar a expressão
do gene Oct4.
No presente trabalho, demonstrar que houve uma redução na expressão proteica
após o silenciamento sugere haver alguma influência do pseudogene Oct4-pg1 com o
gene Oct4.
Ainda considerando a expressão gênica e proteica do gene Oct4, foi
surpreendente constatar que, embora a expressão do gene Oct4 seja menor na linhagem
não MDR, o que corrobora com Marques e colaboradores (2010), foi esta linhagem que
apresentou uma maior marcação para o anticorpo anti-Oct4.
Outra constatação que merece destaque é que embora o silenciamento tenha
diminuído a expressão gênica e proteica do gene Abcb1, as células sh-POU5F1B não se
tornaram sensíveis a VCR. Este fato sinaliza outros mecanismos de resistência, além da
superexpressão da glicoproteína-P para as células Lucena, como uma maior capacidade
antioxidante e maior quantidade de monômeros de tubulina (Trindade et al., 1999, Votto
et al., 2007 e 2010), o que possibilita o rearranjo do citoesqueleto, principal alvo da
VCR. Neste sentido, Daflon-Yunes e colaboradores (2013) observaram um aumento na
sensibilidade da Lucena e FEPS quando o gene da ABCB1 foi silenciado, no entanto
nunca atingindo os níveis da linhagem celular parental K562. Estes autores também
75
sugerem que esta diferença pode ser devido a outros mecanismos também responsáveis
pelo perfil MDR observado.
Por fim, a marcação nuclear do fator de transcrição Oct4 nas células estudadas
está de acordo com Cauffman et al. (2006). Esses autores demonstraram que a proteína
da isoforma Oct4-A é encontrada no núcleo das células tronco embrionárias e o
anticorpo utilizado no presente trabalho reage com essa proteína. Considerando essas
informações, podemos sugerir que as células estudadas apresentam a isoforma de Oct4
responsável pela característica de célula-tronco.
Concluindo, o presente trabalho foi capaz de demonstrar que as células Lucena
e FEPS sofrem o processo de diferenciação, porém não seguem a mesma linha evolutiva
de sua linhagem parental K562. A diferenciação das células K562 para megacariócitos
valida esta afirmação. Neste processo, o gene Alox-5 teve a expressão reduzida nas três
linhagens; a expressão do gene Oct4 foi reduzida apenas na linhagem FEPS e do Nanog
nas linhagens K562 e FEPS; e o gene Mdr1 teve a sua expressão aumentada na
linhagem K562 após o tratamento com PMA. Por fim, foi possível reportar que existe
uma relação entre o pseudogene Oct4-pg1, o gene Oct4 e o gene que codifica a gp-P. O
silenciamento desse pseudogene, causou uma diminuição na proteína Oct4 e uma
redução protéica e gênica do Mdr1, sugerindo que o pseudogene pode ter um efeito
direto na expressão da gp-P ou indireto, via Oct4.
76
Bibliografia geral
Alberts, B. et al., 2010. Biologia Molecular da Célula. 5.ed. Porto Alegre: Artmed.
1205.p.
Atari, M., Barajas, M., Hernández-Alfaro, F., Gil, C., Fabregat, M., Padró, E.F.,
Giner, L. and Casals, N. (2011). Isolation of pluripotent stem cells from human third
molar dental pulp. Histol. Histopathol. 26, 1057-1070.
Atlasi, Y., Mowla, S. J., Ziaee, A. M., Gokhale , P. J. and Andrews, P. W. (2008).
OCT4 spliced variants are differentially expressed in human pluripotent and nonpluripotent cells. Stem Cells 26, 3068–3074.
Barancíki, M., Stefanková, Z. and Breier, A. (1995). Effect of phorbol myristate
acetate (PMA) on P-glycoprotein mediated vincristine resistance of L1210 Cells. Gen.
Physiol. Biophys. 14, 171—175.
Beachy, P.A., Karhadkar, S. S. and Berman, D. M. (2004). Tissue repair and stem
cell renewal in carcinogenesis. Nature 432, 324-33.
Biedler, J.L. and Riehm, H. (1970). Cellular response to actinomycin D in chinese
hamster cells in vitro: cross-resistance, radioautofraphic cytogenetic studies. Cancer
Res. 30,1174-1184.
Bonnet, D. and Dick, J.E. (1997). Human acute myeloid leukemia is organized as a
hierarchy that originates from a primitive hematopoietic cell. Nat. Med. 3, 730–737.
Butler, T. M., Ziemiecki, A. and Friis, R. R. (1990). Megakaryocytic differentiation
of K562 cells is associated with changes in the cytoskeletal organization and the pattern
of
chromatographically
distinct
forms
of
phosphotyrosyl-specific
protein
pathphosphatases. Cancer Res. 50, 6323–6329.
Cauffman, G., Liebaers, I., Van Steirteghem, A. and Van de Velde, H. (2006).
POU5F1 isoforms show different expression patterns in human embryonic stem cells
and preimplantation embryos. Stem Cells 24, 2685–2691.
Chambers, L., Colby, D., Robertsom, M., Nichols, J., Lee, S., Tweedie, S. and
Smith, A. (2003). Functional expression cloning of nanog, a pluripotency sustaining
factor in embryonic stem cells. Cell 113, 643-655.
Chen, Y., Hu, Y., Zhang, H., Peng, C. and Li, S. (2009). Loss of the Alox5 gene
impairs leukemia stem cells and prevents chronic myeloid leucemia. Nat. Genet. 41,
783-793.
77
Chen, Y., Sullivan, C., Peng, C., Shan, Y., Hu, Y., Li, D. and Li, S. (2011). Atumor
suppressor function of the Msr1 gene in leukemia stem cells of chronic myeloid
leucemia. Blood 118, 390-400.
Clarke, M. F. (2004). Neurobiology: at the root of brain cancer. Nature 432, 281-282.
Colamonici, O. R., Trepel, J. B., and Neckers, L. M. (1985). Phorbol ester enhances
deoxynucleoside incorporation while inhibiting proliferation of K-562 cells. Cytometry
6, 591–596.
Costello, R. T., Mallet, F., Gaugler, B., Sainty, D., Arnoulet, C., Gastaut, J.-A. and
Olive, D. (2000). Human acute myeloid leukemia CD341/CD382 progenitor cells have
decreased
sensitivity
to
chemotherapy
and
fas-induced
apoptosis,
reduced
immunogenicity, and impaired dendritic cell transformation capacities. Cancer Res. 60,
4403–4411.
Daflon-Yunes, N., Pinto-Silva, F. E., Vidal, R. S., Novis, B. F., Berguetti, T., Lopes,
R. R. S., Polycarpo, C. and Rumjanek, V. M. (2013). Characterization of a multidrugresistant chronic myeloid leukemia cell line presenting multiple resistance mechanisms.
Mol. Cell Biochem. 383, 123–135.
Dano, K. (1973) Active outward transport of daunomycin in resistant Ehrlich ascites
tumor cells. Biochem. Biophis. Acta 323,466-483.
Dean, M., Fojo, T. and Bates, S. (2005). Tumour stem cells and drug resistance.
Nature 5, 275-285.
Deyev, I. E. and Polanovsky, O. L. (2004). The oct genes and oct proteins. Mol. Biol.
38, 48-55.
Flens, M. J., Zanan, G. J. R., Van Der Valk, P., Isquierdo, M. A., Schroeijers, A.
B., Scheffer, G. L., Van Der Groep, P., De Haas, M., Meijer, C. J. L. M. and
Scheper, R. J. (1996). Tissue distribution of the multidrug resistance protein. Am. J.
Pathol. 148,1237-1247.
Ford, J. M. and Hait, W. N. (1990). Pharmacology of drugs that alter multidrug
resistance in cancer. Pharmacol. Rev. 42, 155-199.
Fukuda, M. (1981). Tumor-promoting phorbol diester-induced specific changes in cell
surface glycoprotein profile of K562 human leukemic cells. Cancer Res. 41, 4621–
4628.
Gottesman, M. M. and Pastan, I. (1993). Biochemistry of multidrug resistance
mediated by the multidrug transporter. Annu Rev Biochem. 62, 385-427.
78
Herrera, R., Hubbell, S., Decker, S. and Petruzzelli, L. (1998). A Role for the
MEK/MAPK pathway in PMA-induced cell cycle arrest: modulation of megakaryocytic
differentiation of K562 cells. Exp. Cell Res. 238, 407–414.
Hirose, K., Monzen, S., Sato, H., Sato, M., Aoki, M., Hatayama, Y., Kawaguchi,
H., Narita, Y., Takai, Y. and Kashiwakura, I. (2013). Megakaryocytic differentiation
in human chronic myelogenous leucemia K562 cells induced by ionizing radiation in
combination with phorbol 12-myristate 13-acetate. J. Radiat. Res. 54, 1–9.
Hocevar, B. A., Morrow, D. M., Tykocinski, M. L. and Fields, A. P. (1992). Protein
kinase C isotypes in human erythroleukemia cell proliferation and differentiation. J.
Cell Sci. 101, 671-679.
Huo, X. F., Yu, J., Peng, H., Du, Z. -W., Liu, X. L., Ma, Y. –N., Zhang, X., Zhang,
Y., Zhao, H. Lu. and Zhang, J. W. (2006). Differential expression changes in K562
cells during the hemin-induced erythroid differentiation and the phorbol myristate
acetate (PMA)-induced megakaryocytic differentiation. Mol. Cell Biochem. 292, 155–
167.
Hayashi, H., Arao, T., Togashi, Y. , Kato, H., Fujita, Y., Velasco, M. D., Kimura,
H., Matsumoto, K., Tanaka, K., Okamoto, I. et al. (2013). The OCT4 pseudogene
POU5F1B is amplified and promotes an aggressive phenotype in gastric câncer.
Oncogene 1–10.
Herzog, E.L., Chai, L. and Krause, D.S. (2003). Plasticity of marrow-derived stem
cells. Blood 10, 3483-3493.
Hirotsune, S., Yoshida, N., Chen, A., Garrett, L., Sugiyama, F., Takahashi, S.,
Yagami, K., Wynshaw-Boris, A. and Yoshiki, A. (2003). An expressed pseudogene
regulates the messenger-RNA stability of its homologous coding gene. Nature 423, 91–
96.
Hoffbrand, A.V. and Moss A.H. (2012). Fundamentos de hematologia. 6.ed. Porto
Alegre: Artmed. 191.p.
Holyoake, T., Jiang, X., Eaves, C. and Eaves, A. (1999). Isolation of a highly
quiescent subpopulation of primitive leukemic cells in chronic myeloid leukemia. Blood
94, 2056-2064.
Jiang, Y., He, Y., Li, H., Li, H.-N., Zhang, L., Hu, W., Sun, Y.-M., Chen, F-L. and
Jin, X-M. (2012). Expressions of putative cancer stem cell markers ABCB1, ABCG2,
79
and CD133 are correlated with the degree of differentiation of gastric câncer. Gastric
Cancer 15, 440–450.
Jiang, Y., Jahagirdar, B.N., Reinhardt, R.L., Schwartz, R.E., Keenek, D., OrtizGonzalesk, X.R., Reyes, M., Lenvik, T., Lund, T., Blackstad, M., et al. (2002).
Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418, 41-49.
Jordan, C. T., Guzman, M. L. and Noble, M. (2006). Cancer stem cells. N. Engl. J.
Med. 355, 1253-1261.
Kartner, N. and Ling, V. (1989). Multidrug resistance in cancer. Scientific American.
26-33.
Kim, M., Turnquist, H., Jackson, J., Sqaqias, M., Yan, Y., Gonq, M., Dean, M.,
Sharp, J.G. and Cowan, K. (2002). The multidrug resistance transporter ABCG2
(breast cancer resistance protein 1) effluxes Hoechst 33342 and is overexpressed in
hematopoietic stem cells. Clin. Cancer Res. 8, 22-28.
Lee, J., Kim, H. K., Rho, J. Y., Ham, Y. M. and Kim, Y. (2006). The human OCT-4
isoforms differ in their ability to confer self-renewal. J. Biol. Chem. 281, 33554–33565.
Lengner, C. J., Welstead, G. G. and Jaenisch, R. (2008). The pluripotency regulator
Oct-4. A role in somatic stem cells. Cell Cycle 7, 725-728.
Li, C., Heidt, D. G., Dalerba, P., Burant, C. F., Zhang, L., Adsay, V., Wicha, M.,
Clarke, M. F. and Simeone, D. M. (2007). Identification of pancreatic cancer stem
cells. Cancer Res. 6, 1030-1037.
Li, L. and Neaves, W. B. (2006). Normal stem cells and cancer stem cells: the niche
matters. Cancer Res. 66, 4553-4557.
Lin, H., Shabbir, A., Molnar, M. and Lee, T. (2007). Stem cell regulatory function
mediated by expression of a novel mouse Oct4 pseudogene. Biochem. Bioph. Res.
Commun. 355, 111–116.
Lin, T., Islam, O. and Heese, K. (2006). ABC transporters, neural stem cells and
neurogenesis – a different perspective. Cell Res. 16, 857-871.
Lo, Y. L., Yu, J. C., Chen, S. T., Hsu, G. C., Mau, Y. C., Yang, S. L., Wu, P. E. and
Shen, C. Y. (2007). Breast cancer risk associated with genotypic polymorphism of the
mitotic checkpoint genes: a multigenic study on cancer susceptibility. Carcinogenesis
28, 1079-1086.
80
Long, M. W., Heffner, C. H.,Williams, J. L., Peters, C. and Prochownik, E. V.
(1990). Regulation of megakaryocyte phenotype in human erythroleukemia cells. J.
Clin. Invest. 85, 1072–1084.
Lozzio, C. B. and Lozzio, B. B. (1975). Human chronic myelogenous leukemia cellline with positive Philadelphia chromosome. Blood 45, 321–334.
Maia, R. C., Silva, E. A. C., Harab, R. C., Lucena, M., Pires, V. and Rumjanek, V.
M. (1996a). Sensitivity of vincristine-sensitive K562 and vincristine-resistant K562Lucena 1 cells to anthracyclines and reversal of multidrug resistance. Braz. J. Med. Biol.
Res. 29, 467-472.
Maia, R. C., Wagner, K., Cabral, R. H. and Rumjanek, V. M. (1996b). Heparin
reverses Rhodamine 123 extrusion by multidrug resistant cells. Cancer Letters 106,
101-108.
Marques, D. S., Sandrini, J. Z., Boyle, R. T., Marins, L. F. and Trindade, G. S.
(2010). Relationships between multidrug resistance (MDR) and stem cell markers in
human chronic myeloid leukemia cell lines. Leukemia Res. 34, 757–762.
Marques-Silva, V. M. (1996) Efeito de Moduladores da Diferenciacão Celular no
Processo de Resistência à Múltiplas Drogas, Tese de Doutorado, Universidade Federal
Fluminense, Niterói, RJ, Brasil.
Melo, J. V. and Barnes, D. J. (2007). Chronic myeloid leukaemia as a model of
disease evolution in human cancer. Nat. Rev. Cancer 7, 441–53.
Miyata, T. (2007). Asymmetric cell division during brain morphogenesi. Prog. Mol.
Subcell. Biol.45,121-142.
Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K.,
Maruyama, M., Maeda, M. and Yamanaka, S. (2003). The homeoprotein nanog is
required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 113, 631642.
Moreira, M. A. M., Bagni, C., Pinho, M. B., Mac-Cormick, T. M., Mota, M. S.,
Pinto-Silva, F. E., Daflon-Yunes, N. and Rumjanek, V. M. (2014). Changes in gene
expression profile in two multidrug resistant celllines derived from a same drug
sensitive cell line. Leuk. Res. 38, 983-987.
Muller, M., Meyer, C., Zaman, G. J. R., Borst, P., Scheper, R. J., Mulder, N. H.,
De Vries, E. G. E. and Jansen, P. L. M. (1994). Overexpression of the of the
81
multidrug resistance associated protein (MRP) gene results in increased ATP-dependent
glutathione S-conjugate transport. Proc. Nat. Acad. Sci. USA 91, 13033-13037.
Murray, N. R., Baumgardner, G., P., Burns, D. J. and Fields, A. P. (1993). Protein
kinase C isotypes in human erythroleukemia (K562) cell proliferation and
differentiation. J. Biol. Chem. 268, 15847-15853.
Neyfakh, A. A. (1998). Use of fluorescent dyes as molecular probes for the study of
multidrug resistance. Exp. Cell Res. 174,168-176.
Niwa, H., Miyazaki, J.-i. and Smith, A. G. (2000). Quantitative expression of Oct-3/4
defines differentiation,dedifferentiation or self-renewal of ES cells. Nat. Genet. 24, 372376.
Ohtsuki, S., Kamoi, M., Watanabe, Y., Suzuki, H., Hori, S. and Terasaki, T.
(2007). Correlation of induction of ATP binding cassette transporter A5 (ABCA5) and
ABCB1 mRNAs with differentiation state of human colon tumor. Biol. Pharm. Bull. 30,
1144—1146.
Oliveira, B. R., Figueiredo, M. A., Trindade, G. S. and Marins, L. F. (2015). OCT4
mutations in human erythroleukemic cells: implications for multiple drug resistance
(MDR) phenotype. Mol. Cell. Biochem. 400, 41–50.
Orind, M., Wagner-Souza, K., Maia, R. C. and Rumjanek, V. M. (1997).
Modulation of P-glycoprotein on tumour cells. Calcium and Cellular Metabolism:
Transport and Regulation (Sotelo, J. R. and Benech, J. C., eds), pp. 117–124, Plenum
Press, New York.
Pain, D., Chirn, G.W., Strassel, C. and
Kemp, D.M. (2005). Multiple
retropseudogenes from pluripotent cell-specific gene expression indicates a potential
signature for novel gene identification. J. Biol. Chem. 280, 6265–6268.
Papamichos, S. I., Kotoula,V., Tarlatzis, B. C., Agorastos, T., Papazisis, K. and
Lambropoulos, A. F. (2009). OCT4B1 isoform: the novel OCT4 alternative spliced
variant as a putative marker of stemness. Mol. Hum. Reprod. 15, 269–270.
Pesce, M., Wang, X., Wolgemuth, D. J. and Scholer, H. (1998). Differential
expression of the Oct-4 transcription factor during mouse germ cell differentiation.
Mech. Dev. 71, 89–98.
Pokharel, M. (2012). Leukemia: A Review Article. Int. J. Pharm. Bio. 2, 397-407.
82
Ponton, A., Thirion, J. P. and Sirois, P. (1996). Changes in chromatin conformation
regulate the 5-1ipoxygenase gene expression during differentiation of HL60 cells.
Prostag. Leukotr. Ess. 55, 139-143.
Riether, C., Schürch, C. M. and Ochsenbein, A. F. (2015).
Regulation of
hematopoietic and leukemic stem cells by the immune system. Cell Death Differ. 22,
187–198.
Rowley, J.D. (1973). A new consistent chromosome abnormality in chronic
myelogenous leukemia. Nature 243, 209-291.
Rumjanek, V. M., Lucena, M., Campos, M. M., Marques-Silva, V. M. and Maia, R.
C. (1994). Multidrug resistance in leukemias: the problem and some approaches to its
circumvention. Ciência e Cultura J. Braz. Assoc. Adv. Sci. 46, 63–69.
Rumjanek, V. M., Trindade, G. S., Wagner-Souza, K., Meletti-de-Oliveira, M. C.,
Marques-Santos, L. F., Maia, R. C. and Capella, M. A. M. (2001). Multidrugresistance in tumor cells: characterization of the multidrug resistant cell line K562Lucena 1. Ann. Acad. Bras. Cienc. 73, 57–69.
Scharenberg, C. W., Harkey, M. A. and Torok-Storb, B. (2002). The ABCG2
transporter is an efficient Hoechst 33342 efflux pump and is preferentially expressed by
immature human hematopoietic progenitors. Blood 99, 507-512.
Schinkel, A. H. (1997). The physiological function of drug-transporting Pglycoproteins. Semin. Cancer Biol. 8, 161-70.
Schönitzer, V., Wirtz, R., Ulrich, V., Berger, T., Karl, A., Mutschler., W.,
Schieker, M. and Böcker, W. (2014). Sox2 is a potent inhibitor of osteogenic and
adipogenic differentiation in human mesenchymal stem cells. Cell. Reprogram. 16, 355365.
Scholer, H. R., Balling, R., Hatzopoulos, A. K., Suzuki, N. and Gruss, P. (1989).
Octamer binding proteins confer transcriptional activity in early mouse embryogenesis.
Embo. J. 8, 2551–2557.
Seke Etet, P. F., Vecchio, L. and Nwabo Kamdje, A. H. (2012). Signaling pathways
in chronic myeloid leukemia and leukemic stem cell maintenance: Key role of stromal
microenvironment. Cell. Signal. 24, 1883-1888.
Sikic, B. (1993). Modulation of multidrug resistance: at the threshold. J. Clin. Oncol.
11, 1629-1635.
83
Sonneveld, P. and Wiemer, E. (1997). Assays for the analysis of P-glycoprotein in
acute myeloid leukemia and CD34 subsets of AML blasts. Leukemia 11, 1160-1165.
Steinhilber, D., Radmark, O. and Samuelsson, B. (1993). Transforming growth
factor f8 upregulates 5-lipoxygenase activity during myeloid cell maturation. Proc.
Natl. Acad. Sci. 90, 5984-5988.
Suo, G., Han, J., Wang, X., Zhang, J., Zhao, Y., Zhao, Y. and Dai, J. (2005). Oct4
pseudogenes are transcribed in cancers. Biochem. Bioph. Res. Commun. 337, 1047–
1051.
Tetteroo, P. A. T., Massaro, F., Mulder, A., Schreuder-van Gelder, R. and Kr. von
dem Borne, A. E. G. (1984). Megakaryoblastic differentiation of proerythroblastic
K562 cell-line cells. Leuk. Res. 8, 197–206.
Tiirikainen, M. I. and Krusius, T. (1991). Multidrug resistance. Ann. Med. 23,509520.
Trindade, G. S., Capella, M. A. M., Capella, L. S., Affonso-Mitidier, O. R. and
Rumjanek, V. M. (1999). Differences in sensitivity to UVC, UVB and UVA radiation
of a multidrug-resistant cell line overexpressing P-glycoprotein. Photochem. Photobiol.
69, 694–699.
Tsai, S. C., Chang, D. F., Hong, C-M., Xia, P., Senadheera, D., Trump, L.,
Mishra, S. and Lutzko, C. (2014). Induced overexpression of OCT4A in human
embryonic stem cells increases cloning efficiency. Am. J. Physiol. Cell Physiol. 306:
C1108–C1118.
Uchiumi, T., Kohno, K., Tanimura, H., Matsu, K., Sato, S., Uchida, Y. and
Kuwano, M. (1993). Enhanced expression of the human multidrug resistance 1 gene in
response to UV light irradiation. Cell Growth Differ. 4, 147-157.
Vanin, E. F. (1985). Processed pseudogenes: chacacteristics and evolution. Ann. Rev.
Genet. 19, 253-272.
Votto, A. P. S., Renon, V. P., Yunes, J. S., Rumjanek, V. M., Capella, M. A. M.,
Moura- Neto, V., Freitas, M. S., Geracitano, L. A., Monserrat, J. M. and Trindade,
G. S. (2007). Sensitivity to microcystins: A comparative study in human cell lines with
and without multidrug resistance phenotype. Cell Biol. Int. 31, 1359-1366.
Votto, A. P. S., Domingues, B. S., Souza, M. M., Silva Júnior, F. M. R., Caldas, S.
S., Filgueira, D. M. V. B., Clementin, R. M., Primel, E. G., Vallochi, A. L., Furlong,
84
E. B., et al. (2010). Toxicity mechanisms of onion (Allium cepa) extracts and
compounds in multidrug resistant erythroleukemic cell line. Biol. Res. 43, 429-437.
Xin, H., Kong, Y., Jiang, X., Wang, K., Qin, X., Miao, Z-H., Zhu, Y. and Tan, W.
(2013). Multi-Drug–Resistant cells enriched from chronic myeloid leukemia cells by
doxorubicin possess tumor-initiating–cell properties. J. Pharmacol. Sci. 122, 299 – 304.
Wang, B., Yu, S. C., Jiang, J.Y., Porter, G. W., Zhao, L. T., Wang, Z., Tan, H.,
Cui, Y.H., Qian, C., Ping, Y. F., et al. (2011). An inhibitor of arachidonate 5lipoxygenase, Nordy, induces differentiation and inhibits self-renewal of glioma stemlike cells. Stem Cell Ver. Rep. 7, 458-470.
Wu, dY. and Yao, Z. (2005). Isolation and characterization of the murine Nanog gene
promoter. Cell Res. 15, 317-324.
Zaman, G. J., Flens, M. J., Van Leusden, M. R., De Haas, M., Mulder, H. S.,
Lankelma, J., Pinedo, H. M., Scheper, R. J., Baas, F., Broxterman, H. J. et al.
(1994). The human multidrug resistance-associated protein MRP is a plasma membrane
drug-efflux pump. Proc. Natl. Acad. Sci. USA 91, 8822-8826.
Zou, G-M. (2007). Cancer stem cells in Leukemia, recent advances. J. Cell. Physiol.
213, 440-444.
85