Texto 5 - pg.com.br -

Propaganda
Governo do Distrito Federal – GDF
Secretaria de Estado de Educação – SE
Gerência Regional de Ensino do Gama – GRE
Centro de Ensino Médio 03 do Gama – CEM 03
Nome do aluno(a)
Valor:
4,0 pontos
Série:
Turma:
Número:
3ª
AVALIAÇÃO INTERDISCIPLINAR DE MATEMÁTICA E CIÊNCIAS DA NATUREZA DO Data
24/04/2008
1º BIMESTRE
Professores: Ronaldo, Dalva, Sônia e Renato.
QUESTÕES TIPO A
Texto 1
Análise Combinatória e Probabilidades
A Análise Combinatória busca estabelecer
processos de contagem – indireta – de diferentes
agrupamentos que podemos formar, a partir dos elementos
de um conjunto dado, usando ou não todos os elementos,
ditos disponíveis. Há agrupamentos que serão vistos como
subconjuntos do conjunto inicial, não interessando a ordem
de colocação de seus elementos, e há os que serão
estudados como sucessões, ou seqüências, cabendo
distinguir quais os seus elementos e em que ordem estão
colocados ou dispostos. Neste caso de seqüências, podendo
repetir elemento, dependendo do problema em questão.
Trata-se, assim, de uma parte da Matemática ao mesmo
tempo relacionada a problemas de nosso dia-a-dia e a
problemas tecnicamente mais sofisticados, quando se faz
uma composição destes recursos da contagem com o cálculo
de Probabilidades e também com a Estatística.
A teoria das Probabilidades, por sua vez, teve
origem despretenciosa, no estudo dos chamados “jogos de
azar”, começando com trabalhos de matemáticos
contratados por jogadores, ou interessados, eles próprios,
em jogar. Tornou-se depois um fundamento sobre o qual se
baseia a Estatística, ciência que visa tirar conclusões e
autorizar a tomada de decisão em determinadas situações
de incerteza, com informações numéricas, por assim dizer,
incompletas. Isto ocorre em nível empresarial, em nível de
governo, além das aplicações científicas, no estudo de
fenômenos físicos, biológicos ou sociais.
Com relação aos estudos de Análise Combinatória e
de Probabilidades, julgue os itens 01 e 02.
01) A senha para um programa de computador consiste em
uma seqüência LLNNN, onde “L” representa uma letra
qualquer do alfabeto normal de 26 letras e “N” é um
algarismo de 0 a 9. Tanto letras como algarismos podem
ou não ser repetidos, mas é essencial que as letras
sejam introduzidas em primeiro lugar, antes dos
algarismos. Sabendo que o programa não faz distinção
entre letras maiúsculas e minúsculas, o número total de
diferentes senhas possíveis é igual a C26,2 . C10,3 .
02) (MPU/2004) Maria ganhou de João nove pulseiras,
quatro delas de prata e cinco delas de ouro. Maria
ganhou de Pedro onze pulseiras, oito delas de prata e
três delas de ouro. Maria guarda todas essas pulseiras
– e apenas essas – em sua pequena caixa de jóias. Uma
noite, arrumando-se apressadamente para ir ao cinema
com João, Maria retira, ao acaso, uma pulseira de sua
pequena caixa de jóias. Ela vê, então, que retirou uma
pulseira de prata. Levando em conta tais informações, a
probabilidade de que a pulseira de prata que Maria
retirou seja uma das pulseiras que ganhou de João é
igual a 9 .
20
Texto 2
Genética e Probabilidade
A genética é, talvez, o ramo da Biologia que mais
utiliza os conceitos matemáticos envolvidos na teoria das
probabilidades. Isso porque, em probabilidade, trabalhamos
com os eventos chamados aleatórios e um bom exemplo de
evento aleatório é o encontro de dois tipos de gametas com
determinados genes. Um indivíduo heterozigoto para
determinada características (Aa) forma dois tipos de
espermatozóides, A e a. Se uma mulher também for
heterozigota, poderá formar óvulos A e a. Depende apenas
do acaso o fato de ser o espermatozóide A ou a o
responsável pela fecundação, assim como também depende
apenas do acaso o fato de ser a célula feminina A ou a a
fecundada.
Diante do texto 1 acima e dos conhecimentos de genética
e probabilidades estudados, julgue os itens 03 a 09.
03) Um casal heterozigoto com pigmentação normal teve
como primeiro descendente uma criança albina. Desta
forma, a probabilidade de, pelo menos, um dos seus
próximos dois filhos ser albino e menino é
aproximadamente 21%.
04) Numa população humana a probabilidade de ser mudo é
estimada em 0,005, a probabilidade de ser cego é
0,0085 e a probabilidade de ser mudo e cego é 0,0006.
Logo, a probabilidade de que um indivíduo, tomado ao
acaso, seja mudo ou cego é de 1,29%.
05) Na população humana citada no item 15, a probabilidade
de um indivíduo ser mudo mas não cego é de 44%.
06) João e sua esposa têm pigmentação normal. João é filho
de um homem normal e mulher albina; Maria é filha de
uma mulher normal e pai albino. A probabilidade de
João e Maria terem uma criança albina do sexo
masculino é 1 .
4
07) Num cruzamento Aa x Aa, sabemos que as combinações
AA, Aa, aA e aa são igualmente prováveis, cada uma
com probabilidade
1 . Sabemos também que Aa e aA
4
não podem ser distinguidas biologicamente. Desta
forma, a probabilidade de ocorrer Aa ou aA, ou seja,
P(Aa

aA) = P(Aa) + P(aA) =
1 +1 =1 .
4 4 2
08) A queratose (anomalia da pele) é devida a um gene
dominante Q. Uma mulher com queratose, cujo pai era
normal, casa-se com um homem com queratose, cuja
mãe era normal. Se esse casal tiver 2 filhos, a
probabilidade de os dois apresentarem queratose é de
56,25% , uma vez que os dois eventos (“a primeira
criança ter queratose” e “a segunda criança ter
queratose”) são independentes.
09) No homem, o albinismo é determinado por um gene na
recessivo a, enquanto a pele normal é determinada pelo
alelo dominante A. Um casal normal tem um filho albino.
A probabilidade de aparecer descendência uma filha
normal é de 75%.
Texto 3
A tabela abaixo mostra os diferentes tipos
sangüíneos, com os correspondentes antígenos, e a sua
distribuição em uma população de 10.000 indivíduos.
Antígenos presentes Tipo Sangüíneo
Número de
indivíduos
A
B
Rh
Não
Não
Não
O-
660
Não
Não
Sim
O+
3.740
Sim
Não
Não
A-
630
Sim
Não
Sim
A+
3.570
Não
Sim
Não
B-
150
Não
Sim
Sim
B+
850
Sim
Sim
Não
AB-
60
Sim
Sim
Sim
AB+
340
No processo de doação de sangue, é preciso que
seja observada a seguinte restrição: se um dos antígenos
não está presente no sangue de um indivíduo, este não pode
receber sangue que contenha aquele antígeno. Com base
nessas informações, julgue os itens 10 a 13, relativos à
população estudada.
10) Se um indivíduo for escolhido aleatoriamente na
população, a chance de ele possuir pelo menos um dos
três antígenos será inferior a 90%.
11) Se um indivíduo for escolhido aleatoriamente na
população, a chance de ele possuir pelo menos dois dos
antígenos será superior a 50%.
12) Se um indivíduo tiver o tipo sangüíneo O+, a chance de
alguém, escolhido aleatoriamente, poder doar sangue
para esse indivíduo será superior a 50%.
13) Se um indivíduo tiver o tipo sangüíneo O+, a chance de
alguém, escolhido aleatoriamente, poder receber
sangue desse indivíduo será superior a 80%.
RASCUNHO
Texto 4
Código Genético Universal
Estabelecido pelas trincas de bases do RNAm
(códons), transcritas do DNA. É constituído por 64 trincas
diferentes (códons e seus aminoácidos correspondentes).
Uma trinca codifica apenas um aminoácido, mas um mesmo
aminoácido pode ser codificado por mais de uma trinca,
havendo, portanto, códons sinônimos. Dos 64 códons, apenas
3 na especificam aminoácidos particulares, representando
sinais de parada que determinam o final da cadeia
polipeptídica.
Relação dos vinte aminoácidos, assim como seus
códons correspondentes.
Considerando
que
a
cadeia
codificadora
ATGCATGCATGCATGCATGC corresponda a um fragmento
da região codificadora de um gene e com o auxílio da tabela
de código genético, julgue os itens 14 a 20 a seguir.
14) O fragmento de DNA ATGCATGCATGCATGCATGC
apresenta 6 códons.
15) O fragmento de RNA mensageiro codificado pelo
fragmento gênico apresentado acima pode ser
traduzido por 6 diferentes tipos de aminoácidos.
16) O RNA é importante no processo de síntese de
proteínas.
17) Um aminoácido pode ser codificado por mais de um
códon.
18) Considerando a cadeia codificadora acima é possível
afirmar que ao trocar a ordem destes elementos
teremos uma permutação de 20 elementos com
repetição de 4 destes elementos (ATGC), ou seja,
P204 .
19) Se mantivermos a seqüência grifada (ATGCA) sempre
junta teremos uma quantidade de diferentes
seqüências determinada por
p5 . p164, 4, 4,3 (Permutação de
5 elementos vezes permutação de 16 elementos, com
repetição tripla de 4 elementos e repetição de 3
elementos).
20) Se formarmos seqüências utilizando apenas um de cada
elemento envolvido na cadeia e se considerarmos ainda
que cada elemento dessa cadeia seja diferente dos
outros (Exemplo: entre os cincos elementos A da
cadeia, considere cinco A diferentes, ou seja, A1, A2,
A3, A4 e A5) teremos um total de seqüências diferentes
determinado por um arranjo simples de 20 elementos
tomados cinco a cinco (
A20,5 ).
Texto 5
Composição química das fragrâncias
As fragrâncias características dos perfumes foram
obtidas durante muito tempo exclusivamente a partir de
óleos essenciais extraídos de flores, plantas, raízes e de
alguns animais selvagens. Esses óleos receberam o nome de
óleos essenciais porque continham a essência, ou seja, aquilo
que confere à planta seu odor característico. Embora esses
óleos sejam ainda hoje obtidos a partir dessas fontes
naturais, têm sido substituídos cada vez mais por
compostos sintéticos (que são usados para aromatizar
produtos de limpeza, produtos de higiene pessoal e criar
ilusões, como deixar o plástico dos assentos de automóveis
com cheiro de couro).
Alguns óleos essenciais chegam a ter mais de 30
componentes. Abaixo estão as fórmulas dos principais
componentes de alguns óleos essenciais.
De acordo com o texto 4 e os conhecimentos de
Química, Julgue os itens 21 a 30.
21) Os perfumes são uma complexa mistura de compostos
orgânicos denominada fragrância.
22) Para os produtos de perfumaria, quanto maior a
porcentagem das essências nas fragrâncias, maior o
preço do produto.
23) O óleo da flor da laranjeira é um hidrocarboneto de
cadeia aberta, apresentando duas ligações duplas e
contendo carbonos primários, secundários e terciários
em sua estrutura.
24) O óleo de jasmim apresenta em sua cadeia fechada
somente átomos de carbono secundários e quaternários.
25) A estrutura do óleo de rosas apresenta cadeia
carbônica mista, insaturada, heterogênia e aromática.
26) O citronelol é um hidrocarboneto de cadeia fechada,
possuindo em sua fórmula ligações simples e ligações
duplas.
27) A fórmula molecular do civetona é C16H30O.
28) O óleo do veado almiscareiro apresenta um
heteroátomo em sua estrutura e seu composto é
formado por 16 carbonos, 30 hidrogênios e um oxigênio.
29) As fragrâncias que encontramos em detergentes,
amaciantes e produto de limpeza, são com freqüência as
mesmas usadas na fabricação dos perfumes.
30) Os óleos essenciais cis-jasmona e 2- fenil etanol
apresentam os mesmos elementos químicos em suas
estruturas e são classificados como hidrocarbonetos.
Texto 6
A
cima, a figura ilustra, em um sistema de coordenadas
cartesianas xOy, as cargas e as linhas de força do dipolo
dessa molécula, em que d é a distância fixa entre as cargas.
S1, S2 e S3 representam superfícies fechadas,
tridimensionais, imaginárias que envolvem linhas de campo
elétrico. O ponto C está localizado no ponto médio dos
pontos onde estão localizadas as cargas do dipolo. Tendo
como base o texto 6, julgue os itens 31 a 33.
31) Em qualquer ponto de uma superfície equipotencial, o
vetor campo elétrico é perpendicular a
superfície.
32) O potencial eletrostático é nulo no ponto C.
essa
33) Sendo a distância entre as cargas Q1 = 8μC e Q2= 2 μC
de 40 cm. Então a força elétrica será igual a 1,44.10 -27.
Texto 7
Um raio ou relâmpago é uma descarga elétrica que
se produz entre nuvens de chuva ou entre uma destas
nuvens e a terra. A descarga é visível com trajetórias
sinuosas e de ramificações irregulares às vezes com muitos
quilômetros de distância, fenômeno conhecido como
relâmpago. Ocorre também uma onda sonora chamada
trovão. Os raios são produzidos pelas diferenças de
potencial nas atmosferas da Terra e de outros planetas. A
descarga ocorre no momento em que as cargas elétricas
(Quantidade de íons, cátions ou ânions) atingem energia
suficiente para superar a resistência elétrica do ar, de
forma explosiva, luminosa e violenta. O aquecimento do ar
causa a expansão explosiva dos gases atmosféricos ao longo
da descarga elétrica, resultando numa violenta onda de
choque (ou de pressão), composta de compressão e
rarefação, que interpretados como "trovão". Uma
tempestade (Em algumas regiões, dá-se a nomenclatura
"trovoada") típica produz três ou quatro descargas por
minuto, em média. O raio tem um diâmetro de 2 a 5 cm e é
capaz de aquecer o ar até 39 000 ºC em alguns
milisegundos. Apenas 1% da energia do raio é convertida em
ruído (trovão) sendo o resto libertado sob a forma de luz. A
descarga elétrica é causada por um intenso campo elétrico
de cerca de 100-400 kN/C (k = 103) entre duas regiões de
cargas opostas, em geral, na parte inferior da nuvem, valor
este que excede o campo local para a quebra de rigidez. De
acordo com os conhecimentos sobre eletrostática, julgue os
itens 34 a 40.
34) os raios são produzidos pelo intenso campo elétrico na
atmosfera terrestre.
35) a descarga elétrica ocorre no momento em que as
cargas elétricas atingem energia suficiente para
superar a resistência elétrica do ar.
36) sendo o raio de diâmetro de 2 cm e o campo elétrico de
100 KN/C, então o potencial elétrico de uma nuvem é
aproximadamente superior há 1000 V.
37) Se a energia total da descarga elétrica for de 12000 J.
Então o total de energia transformada em ruído é de
12 J.
38) uma das formas de se proteger das tempestades é se
abrigar próximos às árvores, porque a madeira é um
ótimo isolante elétrico, evitando maiores danos.
39) sendo o raio da descarga elétrica entre 2 a 5 cm, a
temperatura pode ser de aproximadamente 39000ºC.
40) Se o campo elétrico de 400 kN/C com um raio de
diâmetro de 5 cm, então a carga elétrica é de
aproximadamente 2,8.10-8 C
QUESTÕES TIPO B
QUESTÃO 1
Uma pessoa vai retirar dinheiro num caixa
eletrônico de um banco, mas, na hora de digitar a senha,
esquece-se do número. Ela lembra que o número tem 5
algarismos, começa com 6, não tem algarismos repetidos e
tem o algarismo 7 em alguma posição. O número máximo de
tentativas para acertar a senha é: (OBS: Divida o valor
calculado por 10 e despreze, caso exista, a parte
fracionária desse resultado)
QUESTÃO 2
Os combustíveis, como o gás natural (mistura de
metano, etano, isobutano e pentano), o gás de nafta
(mistura de hidrogênio, metano, pentano, monóxido de
carbono e gás carbônico), usados no gás encanado, e ainda o
gás de botijão (GLP: mistura de propano e butano), na
verdade, não tem cheiro.
Entretanto, para alertar quanto aos perigosos
vazamentos, que podem causar explosão, coloca-se nesses
gases um composto de enxofre, que vai dar aquele cheirinho
desagradável e evidentemente nos alerta do perigo.
Com base nas informações do texto, descubra a fórmula
estrutural dos seguintes compostos orgânicos: pentano,
butil, isobutil e metano. Em seguida faça a soma de todos os
átomos de C e H existentes nessas substâncias e marque no
gabarito.
QUESTÃO 3
Apesar de até o momento já terem sido descritas
várias mutações no gene que codifica a proteína CFTR, a
incidência da fibrose cística ( FC ) é calculada a partir do
quadro clínico e não da verificação do alelo específico
presente na pessoa afetada. Considerando o indivíduo
afetado com FC como homozigoto recessivo e que a
incidência dessa doença na população brasileira seja de 1
para cada 10.000 indivíduos, calcule a probabilidade de um
casal de indivíduos da população brasileira que são
heterozigotos para o gene que codifica a proteína CFTR
gerar uma criança com FC. Para a marcação na folha de
respostas, considere o resultado em porcentagem.
QUESTÃO 4
Em três vértices de um quadrado de lado ℓ = √2 m, fixam-se
cargas elétricas, conforme a figura, sendo o meio o vácuo.
Determine o potencial elétrico resultante no centro do
quadrado. Dado: K = 9.109 Nm2/C2. Despreze a potência caso
exista.
RASCUNHO
QUESTÕES TIPO C
QUESTÃO 1
A pseudo-acondoplasia é um tipo de nanismo determinado
geneticamente pelo alelo D autossômico dominante que
interfere no crescimento dos ossos durante o
desenvolvimento. A princípio, pensou-se que o fenótipo anão
seria expresso pelo genótipo DD ou Dd. Entretanto, foi
considerado que a severidade do alelo dominante, quando em
dose dupla, produz efeito letal durante o desenvolvimento
embrionário, provocando aborto precocemente. Considere
um casal de anões pseudo-acondroplásicos e marque a
alternativa correta:
a) Caso a mulher desse casal venha a dar à luz a uma
criança,
a
probabilidade
de
ela
nascer
geneticamente com pseudo-acondroplasia é de
50%.
b) O casal seria homozigoto dominante.
c) Se o casal tem planos para ter uma menina normal
em relação a essa condição genética, a
probabilidade que se espera para esse evento é de
1/3.
d) Como o casal já tem três crianças com a pseudoacondroplasia , a probabilidade de, em um eventual
quarto nascimento, a criança nascer também
afetada é de ¼ ou 25%.
e) Em uma outra família, com 3 meninas e 2 meninos,
todos apresentando a pseudo-acondroplasia não há
nenhuma criança homozigota dominante, visto que o
gene dominante D é letal em homozigose.
f) Todos os indivíduos normais são dominantes.
g) O gene para pseudo-acondroplasia é homozigoto
recessivo.
QUESTÃO 2
Sabendo que, no heredograma abaixo, os indivíduos em
negrito são polodáctilos ( tem mais de 5 dedos), assinale a
alternativa incorreta.
a)
b)
c)
d)
e)
f)
g)
Se a mulher 6 se casar com um homem que tenha o
mesmo genótipo de seu pai, terá 50% de chance de
ter filhos normais.
O indivíduo 7 e 12 têm o mesmo genótipo.
Trata-se de uma característica autossômica
dominante
O casal 12 X 13 tem 75% de probabilidade de ter
filhos polidáctilos.
O casal 3 X 4 não pode ter filhos polidáctilos.
Todos os indivíduos normais são homozigotos
recessivos
O indivíduo 14 é neta do casal 7 X 8.
QUESTÃO 3
QUESTÃO 6
Dois corpos A e B são eletrizados por atrito e em seguida
um corpo C, inicialmente neutro, é eletrizado por contato
com B. sabendo-se que na eletrização por atrito B perdeu
elétrons para A, pode-se afirmar que ao final desses
processos as cargas de A. B e C são, respectivamente:
a) Positiva, positiva e positiva.
b) Positiva, negativa e positiva.
c) Negativa, negativa e negativa.
d) Negativa, positiva e positiva.
e) Negativa, negativa e positiva.
f) Positiva, positiva e negativa.
g) Positiva, negativa e negativa.
Muitos dos compostos aromáticos são comprovadamente
agentes cancerígenos; entre eles, um dos mais potentes é o
benzopireno, cuja fórmula estrutural é:
QUESTÃO 4
Na determinação do valor de uma carga elétrica
puntiforme, observamos que, em um determinado ponto do
campo elétrico por ela gerado, o potencial elétrico é de
18 kV (k = 103) e a intensidade do vetor elétrico é de
9 k N/C, o valor dessa carga é:
a) 1 μC
b) 0,5 μC
c) 2 μC
d) 3 μC
e) 4 μC
f) 5 μC
g) 6 μC
QUESTÃO 5
O AZT (3 - azido – 3 – deoxitimidina), que possui a
capacidade inibir a infecção e os efeitos citopáticos dos
vírus da imunodeficiência do tipo HIV, o agente causador da
Aids, apresenta a seguinte estrutura:
I – Estão presentes na estrutura da molécula do AZT 16
átomos de carbono.
II – A fórmula química do composto acima é C11H14N3O3.
III – A substância AZT, apresenta três átomos de
carbonos primário, três secundário e 1 terciário.
IV – O composto químico AZT possui heteroátomos na sua
cadeia carbônica.
São corretas:
a) I e II
b) I e III
c) I e IV
d) II e III
e) II e IV
f) III e IV
g) Todas
São feitas as seguintes afirmações referentes a estrutura
desse composto:
I.
É uma cadeia aromática e saturada.
II.
É uma cadeia aromática, homogênia e
insaturada
III.
Na sua fórmula há somente carbonos
secundários e terciários
IV.
Na estrutura do bezopireno existem 20
átomos de C e 11 átomos de H.
Dentre
a)
b)
c)
d)
e)
f)
g)
as afirmações acima, apenas esta(ão) correta(s):
I
II
I e II
II e III
I,II e IV
III e IV
IV
Texto para as questões 7 e 8
(ENEM-1998) Em um concurso de televisão, apresentam-se
ao participante 3 fichas voltadas para baixo, estando
representadas em cada uma delas as letras T, V e E. As
fichas encontram-se alinhadas em uma ordem qualquer. O
participante deve ordenar as fichas ao seu gosto, mantendo
as letras voltadas para baixo, tentando obter a sigla TVE.
Ao desvirá-las, para cada letra que esteja na posição
correta ganhará um prêmio de R$ 200,00.
QUESTÃO 7
A probabilidade de o participante não ganhar qualquer
prêmio é igual a:
a) 0 b) 1
c) 1
d) 1
e) 1
f) 2
g) 1
3
4
2
6
3
5
QUESTÃO 8
A probabilidade de o concorrente ganhar exatamente o
valor de R$ 400,00 é igual a:
a) 0 b) 1
c) 1
d) 2
e) 1
f) 1
g) 1
3
2
3
6
5
4
Download
Random flashcards
Anamnese

2 Cartões oauth2_google_3d715a2d-c2e6-4bfb-b64e-c9a45261b2b4

A Jornada do Herói

6 Cartões filipe.donner

teste

2 Cartões juh16

Criar flashcards