Mini-teste2

Propaganda
BIOLOGIA CELULAR E MOLECULAR
Mestrado Integrado em Engenharia Biomédica
Universidade de Coimbra
Mini-teste
15 de Dezembro 2008
Nome:_________________________________________________________________
Nº de aluno:___________________________
1. Uma das cadeias de uma molécula de DNA de cadeia dupla tem as seguintes
características:
 20% dos nucleótidos que contêm a base citosina têm um nucleótido
contendo guanina ligado na posição 3’;
 30% dos nucleótidos que contêm a base citosina têm um nucleótido
contendo timina ligado na posição 3’;
 25% dos nucleótidos que contêm a base citosina têm um nucleótido
contendo citosina ligado na posição 3’;
 25% dos nucleótidos que contêm a base citosina têm um nucleótido
contendo adenina ligado na posição 3’.
Na cadeia complementar, qual a frequência de ocorrência das várias bases na
posição 5’ relativamente aos nucleótidos contendo guanina?
2. Os cromossomas eucariotas têm extremidades repetitivas, designadas por
telómeros, que não existem nos cromossomas bacterianos. Tendo em conta o
mecanismo de replicação de DNA, por que razão é importante a presença de
telómeros nos cromossomas eucariotas?
3. Numa célula eucariota, todo o material genético é replicado durante a fase de
síntese de DNA do ciclo celular. No entanto, só parte do material genético da
célula é transcrito durante o tempo de vida da célula. Como são seleccionadas as
porções de DNA a transcrever numa célula num determinado momento do seu
tempo de vida?
4. Um segmento de uma cadeia peptídica tem a sequência Ala-Ile-Ala-Cys-SerThr-Tyr, e é codificado pelo seguinte fragmento de DNA:
GCGATAGCATGCAGTACGTAC
CGCTATCGTACGTCATGCATG
Qual a cadeia de DNA que serve de cadeia codificante durante a transcrição? Indique
a polaridade (5’, 3’) de cada uma das cadeias de DNA.
Fig. 1. Código genético.
5. Está interessado em estudar o desenvolvimento do olho em rato, e o seu
laboratório descobriu recentemente um gene, o BLG1, que causa o
desenvolvimento de olhos anormalmente grandes no rato. Suspeita que este gene
possa estar envolvido na proliferação de outros tecidos, de modo que isolou
diferentes tecidos de rato em desenvolvimento. Fez um “western blot” destes
tecidos usando um anticorpo que reconhece um peptídeo da proteína codificada
pelo gene BLG1, e obteve os seguintes resultados:
olho
fígado
cérebro
pulmão
músculo
a) Como poderá justificar as diferentes mobilidades da proteína BLG1 presente no
cérebro e no músculo.
b) Sugira uma estratégia experimental para caracterizar a distribuição da proteína
BLG1 na célula.
´
Download
Random flashcards
paulo

2 Cartões paulonetgbi

A Jornada do Herói

6 Cartões filipe.donner

paulo

2 Cartões oauth2_google_ddd7feab-6dd5-47da-9583-cdda567b48b3

Criar flashcards